Transcript: Human NM_015993.3

Homo sapiens plasmolipin (PLLP), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PLLP (51090)
Length:
1497
CDS:
133..681

Additional Resources:

NCBI RefSeq record:
NM_015993.3
NBCI Gene record:
PLLP (51090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421737 GCCTCGTTCTTTGCGTGTTTG pLKO_005 559 CDS 100% 10.800 8.640 N PLLP n/a
2 TRCN0000182926 CACTGGTGTTAATGATCTTTA pLKO.1 434 CDS 100% 13.200 9.240 N PLLP n/a
3 TRCN0000181165 CCCAAGCCTCTCTCTGTAATA pLKO.1 1316 3UTR 100% 13.200 9.240 N PLLP n/a
4 TRCN0000433823 CCTTCTCACCAGCACTAAATG pLKO_005 1000 3UTR 100% 13.200 9.240 N PLLP n/a
5 TRCN0000150056 CCACTGGTGTTAATGATCTTT pLKO.1 433 CDS 100% 5.625 3.938 N PLLP n/a
6 TRCN0000434862 AGCTGCACATGAAGTTGTACA pLKO_005 401 CDS 100% 4.950 3.465 N PLLP n/a
7 TRCN0000180245 CCTCTTCAACCTCTACCTGTT pLKO.1 378 CDS 100% 4.050 2.835 N PLLP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03201 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03201 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471173 TCGAATAAAACCCTCCCTTTAACC pLX_317 80.3% 100% 100% V5 n/a
Download CSV