Transcript: Human NM_016048.2

Homo sapiens isochorismatase domain containing 1 (ISOC1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
ISOC1 (51015)
Length:
1942
CDS:
19..915

Additional Resources:

NCBI RefSeq record:
NM_016048.2
NBCI Gene record:
ISOC1 (51015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143931 CCATTTGAGTACCAGCATTTA pLKO.1 1071 3UTR 100% 13.200 18.480 N ISOC1 n/a
2 TRCN0000140230 GTCGAGGTTCACATTGTTGCT pLKO.1 700 CDS 100% 2.640 3.696 N ISOC1 n/a
3 TRCN0000141622 CAGACCAGCCATCAAGTATTT pLKO.1 396 CDS 100% 13.200 9.240 N ISOC1 n/a
4 TRCN0000139646 CCAGAAGTAGAAGCGGCATTA pLKO.1 586 CDS 100% 10.800 7.560 N ISOC1 n/a
5 TRCN0000144708 GTACTTCCAAAGACCAAGTTT pLKO.1 553 CDS 100% 5.625 3.938 N ISOC1 n/a
6 TRCN0000141642 CCTCACAATGTTGTCCACTTA pLKO.1 1418 3UTR 100% 4.950 3.465 N ISOC1 n/a
7 TRCN0000140596 GAAGCGGCATTAGCAGAGATT pLKO.1 595 CDS 100% 4.950 3.465 N ISOC1 n/a
8 TRCN0000142186 GAGGTTCACATTGTTGCTGAT pLKO.1 703 CDS 100% 4.050 2.835 N ISOC1 n/a
9 TRCN0000140633 GCTGTGATATGCAGGAAAGGT pLKO.1 374 CDS 100% 3.000 2.100 N ISOC1 n/a
10 TRCN0000139189 CCCTGGGAAATCTTACACCTT pLKO.1 335 CDS 100% 2.640 1.848 N ISOC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11934 pDONR223 100% 78.8% 78.8% None 1_189del n/a
2 ccsbBroad304_11934 pLX_304 0% 78.8% 78.8% V5 1_189del n/a
3 TRCN0000469611 TTGACTCCTTATGGGCAATCTTTC pLX_317 58.3% 78.8% 78.8% V5 1_189del n/a
4 ccsbBroadEn_11935 pDONR223 100% 78.7% 78.8% None 1_189del;298T>C n/a
5 ccsbBroad304_11935 pLX_304 0% 78.7% 78.8% V5 1_189del;298T>C n/a
6 TRCN0000475151 TAAGCCTATCACCCTCATACCAAG pLX_317 57.5% 78.7% 78.8% V5 1_189del;298T>C n/a
Download CSV