Transcript: Human NM_016056.3

Homo sapiens transmembrane BAX inhibitor motif containing 4 (TMBIM4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TMBIM4 (51643)
Length:
1878
CDS:
122..838

Additional Resources:

NCBI RefSeq record:
NM_016056.3
NBCI Gene record:
TMBIM4 (51643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016056.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159316 GCTTTCATACTGACTACTACA pLKO.1 500 CDS 100% 4.950 6.930 N TMBIM4 n/a
2 TRCN0000165512 GTACATGAGAGTCCTGCCTTA pLKO.1 317 CDS 100% 4.050 3.240 N TMBIM4 n/a
3 TRCN0000428227 ACACACTCACTGATGCATAAA pLKO_005 713 CDS 100% 13.200 9.240 N TMBIM4 n/a
4 TRCN0000414108 AGATAATGGAGTTGGTCTTAG pLKO_005 648 CDS 100% 10.800 7.560 N TMBIM4 n/a
5 TRCN0000429517 GCAGTATATAGAAACTGTTTC pLKO_005 912 3UTR 100% 10.800 7.560 N TMBIM4 n/a
6 TRCN0000159421 GCAGTTGTTGTTACTTTCTAT pLKO.1 458 CDS 100% 5.625 3.938 N TMBIM4 n/a
7 TRCN0000158586 CTTGATTTAGGATCTCAGTTA pLKO.1 1050 3UTR 100% 4.950 2.970 N TMBIM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016056.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12003 pDONR223 100% 19.3% 15.1% None 97_134del;177_714del n/a
2 ccsbBroad304_12003 pLX_304 0% 19.3% 15.1% V5 97_134del;177_714del n/a
3 TRCN0000479450 CTGCAATGGTCACAGGGCTGTTTT pLX_317 100% 19.3% 15.1% V5 97_134del;177_714del n/a
Download CSV