Transcript: Human NM_016091.4

Homo sapiens eukaryotic translation initiation factor 3 subunit L (EIF3L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
EIF3L (51386)
Length:
2669
CDS:
32..1726

Additional Resources:

NCBI RefSeq record:
NM_016091.4
NBCI Gene record:
EIF3L (51386)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016091.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074844 GCAGAGGTTTGAATCCTATTA pLKO.1 484 CDS 100% 13.200 10.560 N EIF3L n/a
2 TRCN0000307934 GCAGAGGTTTGAATCCTATTA pLKO_005 484 CDS 100% 13.200 10.560 N EIF3L n/a
3 TRCN0000074846 CCTGGTAGACAAATCCAACAT pLKO.1 730 CDS 100% 4.950 3.465 N EIF3L n/a
4 TRCN0000307937 CCTGGTAGACAAATCCAACAT pLKO_005 730 CDS 100% 4.950 3.465 N EIF3L n/a
5 TRCN0000074845 CCTTGCTTATGAACGTCAGTA pLKO.1 130 CDS 100% 4.950 3.465 N EIF3L n/a
6 TRCN0000292011 CCTTGCTTATGAACGTCAGTA pLKO_005 130 CDS 100% 4.950 3.465 N EIF3L n/a
7 TRCN0000074847 CTGGGATATTATCGATGAGTT pLKO.1 580 CDS 100% 4.950 3.465 N EIF3L n/a
8 TRCN0000292010 CTGGGATATTATCGATGAGTT pLKO_005 580 CDS 100% 4.950 3.465 N EIF3L n/a
9 TRCN0000074843 ACACACATTCAGGAACCTGTT pLKO.1 1735 3UTR 100% 4.050 2.835 N EIF3L n/a
10 TRCN0000292009 ACACACATTCAGGAACCTGTT pLKO_005 1735 3UTR 100% 4.050 2.835 N EIF3L n/a
11 TRCN0000138395 CCTTCCAAGTAGCTGGGATTA pLKO.1 2121 3UTR 100% 10.800 5.400 Y C11orf88 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2436 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016091.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03296 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03296 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469269 AATGCGTGTTAACGGGATACGATT pLX_317 21% 100% 100% V5 n/a
4 ccsbBroadEn_15838 pDONR223 0% 99.9% 100% None 1146T>C n/a
5 ccsbBroad304_15838 pLX_304 0% 99.9% 100% V5 1146T>C n/a
6 TRCN0000477125 ATTACAACTCCCTTTCCAAACAGC pLX_317 21.7% 99.9% 100% V5 1146T>C n/a
Download CSV