Transcript: Human NM_016112.3

Homo sapiens polycystin 2 like 1, transient receptor potential cation channel (PKD2L1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PKD2L1 (9033)
Length:
2790
CDS:
126..2543

Additional Resources:

NCBI RefSeq record:
NM_016112.3
NBCI Gene record:
PKD2L1 (9033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016112.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056106 CCACTACTGGACAGTTTGTAT pLKO.1 615 CDS 100% 5.625 7.875 N PKD2L1 n/a
2 TRCN0000428650 ATTGATGCTGTAGGCTCAAAG pLKO_005 2307 CDS 100% 10.800 8.640 N PKD2L1 n/a
3 TRCN0000056105 GCCATCATCAATGACACATAT pLKO.1 1797 CDS 100% 13.200 9.240 N PKD2L1 n/a
4 TRCN0000415612 ACTACAATGCTATCGACAATG pLKO_005 1699 CDS 100% 10.800 7.560 N PKD2L1 n/a
5 TRCN0000418768 CCCACTCCTTCATCTACTATG pLKO_005 676 CDS 100% 10.800 7.560 N PKD2L1 n/a
6 TRCN0000056103 GCCGTCATGTTCTTCATTGTT pLKO.1 1566 CDS 100% 5.625 3.938 N PKD2L1 n/a
7 TRCN0000056104 GCTGGGTTTCAGGAGAAGAAT pLKO.1 2224 CDS 100% 5.625 3.938 N PKD2L1 n/a
8 TRCN0000056107 CCTCCATATCTGTCAAGGCAT pLKO.1 335 CDS 100% 2.640 1.848 N PKD2L1 n/a
9 TRCN0000434497 CTACAACAAGACCCTACTAAG pLKO_005 1886 CDS 100% 10.800 6.480 N PKD2L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016112.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07343 pDONR223 100% 99.9% 99.8% None 1786C>T n/a
2 ccsbBroad304_07343 pLX_304 0% 99.9% 99.8% V5 1786C>T n/a
3 TRCN0000479162 GCTTTTTACAGAAGAATATCGCAT pLX_317 17% 99.9% 99.8% V5 1786C>T n/a
Download CSV