Transcript: Human NM_016148.5

Homo sapiens SH3 and multiple ankyrin repeat domains 1 (SHANK1), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SHANK1 (50944)
Length:
9636
CDS:
441..6926

Additional Resources:

NCBI RefSeq record:
NM_016148.5
NBCI Gene record:
SHANK1 (50944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016148.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138405 CGTGTATCAGATGGCTCTCAA pLKO.1 2879 CDS 100% 4.950 6.930 N SHANK1 n/a
2 TRCN0000136996 CCAAGCTTAATGGATGGGATT pLKO.1 2373 CDS 100% 4.050 5.670 N SHANK1 n/a
3 TRCN0000136791 CCAATTACCATGACTCGGATT pLKO.1 1054 CDS 100% 4.050 5.670 N SHANK1 n/a
4 TRCN0000138436 CCCGAGTTTACAAACAGACCA pLKO.1 913 CDS 100% 2.640 3.696 N SHANK1 n/a
5 TRCN0000422984 AGAGACTCTTCCGGCATTATA pLKO_005 2323 CDS 100% 15.000 10.500 N SHANK1 n/a
6 TRCN0000438068 CATCGACCGGGCTCTCAAATT pLKO_005 6890 CDS 100% 13.200 9.240 N SHANK1 n/a
7 TRCN0000137144 GTTGAAGAAGTTCCTGGAGTA pLKO.1 977 CDS 100% 4.050 2.835 N SHANK1 n/a
8 TRCN0000137104 CCGAGTTTACAAACAGACCAA pLKO.1 914 CDS 100% 2.640 1.848 N SHANK1 n/a
9 TRCN0000138841 GCTCTCAACAAACTGGACGAA pLKO.1 2892 CDS 100% 2.640 1.848 N SHANK1 n/a
10 TRCN0000137382 GATGTGAAGAACAACAACGGA pLKO.1 1560 CDS 100% 0.750 0.525 N SHANK1 n/a
11 TRCN0000242045 AGTTCCTGGACCACGAGATTG pLKO_005 6793 CDS 100% 10.800 7.560 N Shank1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016148.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.