Transcript: Human NM_016176.4

Homo sapiens stromal cell derived factor 4 (SDF4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
SDF4 (51150)
Length:
1933
CDS:
264..1352

Additional Resources:

NCBI RefSeq record:
NM_016176.4
NBCI Gene record:
SDF4 (51150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016176.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422169 AGATTAAACTTCGCTGGAAAT pLKO_005 1774 3UTR 100% 10.800 15.120 N SDF4 n/a
2 TRCN0000429650 GAGTAAAGGCCATAGCGAGAA pLKO_005 767 CDS 100% 4.050 5.670 N SDF4 n/a
3 TRCN0000418447 TGTGAACACTGACCGGAAGAT pLKO_005 596 CDS 100% 4.950 3.960 N SDF4 n/a
4 TRCN0000421674 GGCTCAACGAGGAACTCAAAG pLKO_005 808 CDS 100% 10.800 7.560 N SDF4 n/a
5 TRCN0000056054 GACGAGTATAAGGTGAAGTTT pLKO.1 741 CDS 100% 5.625 3.938 N SDF4 n/a
6 TRCN0000419154 AGCGCTGGATCATGGAGAAGA pLKO_005 634 CDS 100% 4.950 3.465 N SDF4 n/a
7 TRCN0000056056 CAACTGGGTGAAAGACAGAAA pLKO.1 1091 CDS 100% 4.950 3.465 N SDF4 n/a
8 TRCN0000056053 GCTCAAGTACAGCGAGTTCTT pLKO.1 1280 CDS 100% 4.950 3.465 N SDF4 n/a
9 TRCN0000056057 CCGGAGGAAGCTGATGGTCAT pLKO.1 560 CDS 100% 1.350 0.945 N SDF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016176.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08233 pDONR223 100% 99.9% 100% None 570T>C n/a
2 ccsbBroad304_08233 pLX_304 0% 99.9% 100% V5 570T>C n/a
3 TRCN0000479256 AAAAACGTTCGGCATAACTCACAC pLX_317 32.7% 99.9% 100% V5 570T>C n/a
Download CSV