Transcript: Human NM_016183.4

Homo sapiens MRT4 homolog, ribosome maturation factor (MRTO4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MRTO4 (51154)
Length:
2049
CDS:
32..751

Additional Resources:

NCBI RefSeq record:
NM_016183.4
NBCI Gene record:
MRTO4 (51154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016183.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293998 TCGGAGCCCATCTGATGAATA pLKO_005 265 CDS 100% 13.200 9.240 N MRTO4 n/a
2 TRCN0000298668 TGGGCACTGACCTCCTGTAAA pLKO_005 868 3UTR 100% 13.200 9.240 N MRTO4 n/a
3 TRCN0000072700 AGCCGGATGTTCTTTGGCAAA pLKO.1 218 CDS 100% 4.050 2.835 N MRTO4 n/a
4 TRCN0000104359 CCTGATAGAAGAGCTTCGGAA pLKO.1 106 CDS 100% 2.640 1.848 N Mrto4 n/a
5 TRCN0000349387 CCTGATAGAAGAGCTTCGGAA pLKO_005 106 CDS 100% 2.640 1.848 N Mrto4 n/a
6 TRCN0000072699 CTGCCAAGAAAGGCTTGGAAT pLKO.1 75 CDS 100% 0.495 0.347 N MRTO4 n/a
7 TRCN0000286645 CTGCCAAGAAAGGCTTGGAAT pLKO_005 75 CDS 100% 0.495 0.347 N MRTO4 n/a
8 TRCN0000072701 GTGAATGAGTGGTTCACGAAA pLKO.1 365 CDS 100% 0.495 0.347 N MRTO4 n/a
9 TRCN0000286646 GTGAATGAGTGGTTCACGAAA pLKO_005 365 CDS 100% 0.495 0.347 N MRTO4 n/a
10 TRCN0000072702 TGGGTATGAGATGGCTGAATT pLKO.1 610 CDS 100% 0.000 0.000 N MRTO4 n/a
11 TRCN0000298246 TGGGTATGAGATGGCTGAATT pLKO_005 610 CDS 100% 0.000 0.000 N MRTO4 n/a
12 TRCN0000164834 CAAACTCCTGAGCTCAAGCAA pLKO.1 1904 3UTR 100% 3.000 1.500 Y LINC00336 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016183.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08234 pDONR223 100% 99.8% 100% None 330G>A n/a
2 ccsbBroad304_08234 pLX_304 0% 99.8% 100% V5 330G>A n/a
3 TRCN0000466401 TCATGCTGCGCCGTGGGACTGTGA pLX_317 30.2% 99.8% 100% V5 330G>A n/a
Download CSV