Transcript: Human NM_016221.3

Homo sapiens dynactin subunit 4 (DCTN4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DCTN4 (51164)
Length:
3937
CDS:
103..1485

Additional Resources:

NCBI RefSeq record:
NM_016221.3
NBCI Gene record:
DCTN4 (51164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232015 GCTGGTCGCTGTCAATTATAT pLKO_005 999 CDS 100% 15.000 21.000 N DCTN4 n/a
2 TRCN0000232012 ATCGGCTGAAGCCAAACTAAA pLKO_005 279 CDS 100% 13.200 18.480 N DCTN4 n/a
3 TRCN0000232014 CCTCTACCTGAAGACTATTAT pLKO_005 781 CDS 100% 15.000 12.000 N DCTN4 n/a
4 TRCN0000008664 GCCGTAAATGTGAACATAATT pLKO.1 932 CDS 100% 15.000 10.500 N DCTN4 n/a
5 TRCN0000232016 TCACCGTAAACCTGCGTTAAA pLKO_005 1522 3UTR 100% 13.200 9.240 N DCTN4 n/a
6 TRCN0000232013 TTGCCGGACTTTCCCTTAAAG pLKO_005 701 CDS 100% 13.200 9.240 N DCTN4 n/a
7 TRCN0000008665 CCCATTATTGTCCCAGTTGTT pLKO.1 245 CDS 100% 4.950 3.465 N DCTN4 n/a
8 TRCN0000008666 GCTGTCAATTATATTCCAGAA pLKO.1 1006 CDS 100% 4.050 2.835 N DCTN4 n/a
9 TRCN0000008667 GCCTTCAGAAAGGCCAACAAA pLKO.1 1279 CDS 100% 0.563 0.394 N DCTN4 n/a
10 TRCN0000008663 GCACTCTCATTTGCCCTCTTT pLKO.1 2088 3UTR 100% 4.950 2.970 N DCTN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475226 CCGGACCACAACGTAAAGCATTTA pLX_317 29.6% 99.7% 99.5% V5 (many diffs) n/a
2 ccsbBroadEn_08238 pDONR223 100% 99.7% 99.3% None (many diffs) n/a
3 ccsbBroad304_08238 pLX_304 0% 99.7% 99.3% V5 (many diffs) n/a
Download CSV