Transcript: Human NM_016228.4

Homo sapiens aminoadipate aminotransferase (AADAT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
AADAT (51166)
Length:
2250
CDS:
267..1544

Additional Resources:

NCBI RefSeq record:
NM_016228.4
NBCI Gene record:
AADAT (51166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016228.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035054 CCGGACCATGACTGACATATT pLKO.1 323 CDS 100% 13.200 18.480 N AADAT n/a
2 TRCN0000291245 CCGGACCATGACTGACATATT pLKO_005 323 CDS 100% 13.200 18.480 N AADAT n/a
3 TRCN0000035055 CCAGGTATTAGCACAACTTAT pLKO.1 1508 CDS 100% 13.200 9.240 N AADAT n/a
4 TRCN0000291300 CCAGGTATTAGCACAACTTAT pLKO_005 1508 CDS 100% 13.200 9.240 N AADAT n/a
5 TRCN0000035056 CCCTTAATAGAGAGAGTTATT pLKO.1 1101 CDS 100% 13.200 9.240 N AADAT n/a
6 TRCN0000307657 CCCTTAATAGAGAGAGTTATT pLKO_005 1101 CDS 100% 13.200 9.240 N AADAT n/a
7 TRCN0000035058 GCCAGTGATGAAAGTGGGATT pLKO.1 744 CDS 100% 4.050 2.835 N AADAT n/a
8 TRCN0000307661 GCCAGTGATGAAAGTGGGATT pLKO_005 744 CDS 100% 4.050 2.835 N AADAT n/a
9 TRCN0000035057 CCCTTACTTGAGAGCATCCTT pLKO.1 1451 CDS 100% 3.000 2.100 N AADAT n/a
10 TRCN0000291301 CCCTTACTTGAGAGCATCCTT pLKO_005 1451 CDS 100% 3.000 2.100 N AADAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016228.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492234 GTCATGTGGGACACTTACTGTTTA pLX_317 26% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_14139 pDONR223 100% 98.9% 97.9% None 67_68insGTGAGAAACGGG;308C>A;1267delG n/a
3 ccsbBroad304_14139 pLX_304 0% 98.9% 97.9% V5 (not translated due to frame shift) 67_68insGTGAGAAACGGG;308C>A;1267delG n/a
Download CSV