Transcript: Human NM_016289.4

Homo sapiens calcium binding protein 39 (CAB39), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CAB39 (51719)
Length:
3829
CDS:
433..1458

Additional Resources:

NCBI RefSeq record:
NM_016289.4
NBCI Gene record:
CAB39 (51719)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016289.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375639 TCTGCACCCAACAGAATATTT pLKO_005 791 CDS 100% 15.000 21.000 N Cab39 n/a
2 TRCN0000044254 CGAGAAGACCTATTTAGTTAA pLKO.1 1395 CDS 100% 13.200 10.560 N CAB39 n/a
3 TRCN0000290764 CGAGAAGACCTATTTAGTTAA pLKO_005 1395 CDS 100% 13.200 10.560 N CAB39 n/a
4 TRCN0000044255 CGAGAACTCCTACTGTTGAAT pLKO.1 767 CDS 100% 5.625 4.500 N CAB39 n/a
5 TRCN0000290763 CGAGAACTCCTACTGTTGAAT pLKO_005 767 CDS 100% 5.625 4.500 N CAB39 n/a
6 TRCN0000044253 GCCACATTCAAGGATTTACTT pLKO.1 988 CDS 100% 5.625 3.938 N CAB39 n/a
7 TRCN0000290762 GCCACATTCAAGGATTTACTT pLKO_005 988 CDS 100% 5.625 3.938 N CAB39 n/a
8 TRCN0000044257 GAGAAGTTACTTCATTCAGAA pLKO.1 1075 CDS 100% 4.950 3.465 N CAB39 n/a
9 TRCN0000290760 GAGAAGTTACTTCATTCAGAA pLKO_005 1075 CDS 100% 4.950 3.465 N CAB39 n/a
10 TRCN0000044256 GCTACAGAAGAAGTTTCCAAA pLKO.1 547 CDS 100% 4.950 3.465 N CAB39 n/a
11 TRCN0000290761 GCTACAGAAGAAGTTTCCAAA pLKO_005 547 CDS 100% 4.950 3.465 N CAB39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016289.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03372 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03372 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477461 CGGCTTTAAAAAGCCCGTCCCAAC pLX_317 38.7% 100% 100% V5 n/a
Download CSV