Transcript: Human NM_016370.4

Homo sapiens RAB9B, member RAS oncogene family (RAB9B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RAB9B (51209)
Length:
3772
CDS:
315..920

Additional Resources:

NCBI RefSeq record:
NM_016370.4
NBCI Gene record:
RAB9B (51209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016370.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048075 CGTTACGTAACCAACAAATTT pLKO.1 390 CDS 100% 15.000 21.000 N RAB9B n/a
2 TRCN0000232919 ACCGTTACGTAACCAACAAAT pLKO_005 388 CDS 100% 13.200 18.480 N RAB9B n/a
3 TRCN0000048077 ACGCTTTGTAACCCTCCAGAT pLKO.1 473 CDS 100% 4.050 5.670 N RAB9B n/a
4 TRCN0000048074 GTAGAGTTCTTAAATCGAGAT pLKO.1 438 CDS 100% 4.050 5.670 N RAB9B n/a
5 TRCN0000232921 ACTGGCAGAAAGAATTTATTT pLKO_005 613 CDS 100% 15.000 10.500 N RAB9B n/a
6 TRCN0000232923 AGTGCCAAAGATGATACTAAT pLKO_005 774 CDS 100% 13.200 9.240 N RAB9B n/a
7 TRCN0000232920 ATCGGCAGAGCTTCGAGAATC pLKO_005 586 CDS 100% 10.800 7.560 N RAB9B n/a
8 TRCN0000232922 GACTACTGAGGAGGCACAAAC pLKO_005 713 CDS 100% 10.800 7.560 N RAB9B n/a
9 TRCN0000381315 TGGGTAACAAGGTAGACAAAG pLKO_005 679 CDS 100% 10.800 7.560 N Rab9b n/a
10 TRCN0000048073 CTGGGTAACAAGGTAGACAAA pLKO.1 678 CDS 100% 4.950 3.465 N RAB9B n/a
11 TRCN0000048076 TGACTTGAACAGTGGCTCCAA pLKO.1 878 CDS 100% 2.640 1.584 N RAB9B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016370.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03246 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03246 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477393 ACTATTTACATGGATTCATACAGA pLX_317 58.1% 100% 100% V5 n/a
Download CSV