Transcript: Human NM_016410.6

Homo sapiens charged multivesicular body protein 5 (CHMP5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CHMP5 (51510)
Length:
1901
CDS:
31..690

Additional Resources:

NCBI RefSeq record:
NM_016410.6
NBCI Gene record:
CHMP5 (51510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016410.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159946 GAATCCATTGACAAGAAGATT pLKO.1 115 CDS 100% 5.625 3.938 N CHMP5 n/a
2 TRCN0000382194 GACACCAAGACCACGGTTGAT pLKO_005 331 CDS 100% 4.950 3.465 N Chmp5 n/a
3 TRCN0000163206 GAGTTGGATGCACTAGGTGAT pLKO.1 526 CDS 100% 4.050 2.835 N CHMP5 n/a
4 TRCN0000161287 GATGCTATGAAACTGGGAGTA pLKO.1 349 CDS 100% 4.050 2.835 N CHMP5 n/a
5 TRCN0000158654 CTGGATGAAGATGATTTAGAA pLKO.1 502 CDS 100% 5.625 3.375 N CHMP5 n/a
6 TRCN0000161107 GAGGATTTACAAGACCAGCTA pLKO.1 415 CDS 100% 2.640 1.584 N CHMP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016410.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03320 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03320 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469582 ACCTGAGCACGTCTCGGAATGACG pLX_317 56.8% 100% 100% V5 n/a
4 ccsbBroadEn_08303 pDONR223 100% 99.8% 100% None 603A>G n/a
5 ccsbBroad304_08303 pLX_304 0% 99.8% 100% V5 603A>G n/a
6 TRCN0000473937 CCAAAACGATTCATATGGTGAGAA pLX_317 74.4% 99.8% 100% V5 603A>G n/a
7 ccsbBroadEn_15846 pDONR223 0% 99.8% 99.5% None 56A>G n/a
8 ccsbBroad304_15846 pLX_304 0% 99.8% 99.5% V5 56A>G n/a
9 TRCN0000474383 GACTATCGCAGTATATCCCATGCG pLX_317 56.8% 99.6% 99.5% V5 56A>G;531T>C n/a
Download CSV