Transcript: Human NM_016474.5

Homo sapiens coiled-coil domain containing 174 (CCDC174), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CCDC174 (51244)
Length:
2940
CDS:
76..1479

Additional Resources:

NCBI RefSeq record:
NM_016474.5
NBCI Gene record:
CCDC174 (51244)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016474.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128674 CCCACGACTTACTCATATTTA pLKO.1 1785 3UTR 100% 15.000 21.000 N CCDC174 n/a
2 TRCN0000415344 GACATACCTACCTGGATTTAC pLKO_005 1682 3UTR 100% 13.200 18.480 N CCDC174 n/a
3 TRCN0000130401 GAAGATCATAGACAAGCGCAA pLKO.1 423 CDS 100% 2.160 3.024 N CCDC174 n/a
4 TRCN0000128603 CGGAAGTAATCACATAGGAAA pLKO.1 1970 3UTR 100% 4.950 3.960 N CCDC174 n/a
5 TRCN0000426644 GCGATAGAATAGAAGTATTTA pLKO_005 1712 3UTR 100% 15.000 10.500 N CCDC174 n/a
6 TRCN0000417699 ACCATAGGTCACGAGGAATTT pLKO_005 1888 3UTR 100% 13.200 9.240 N CCDC174 n/a
7 TRCN0000419134 GTGGATTACGTGGACTCTTTG pLKO_005 562 CDS 100% 10.800 7.560 N CCDC174 n/a
8 TRCN0000129204 CCAGAGTAGCAAAGTAGAAGT pLKO.1 1092 CDS 100% 4.950 3.465 N CCDC174 n/a
9 TRCN0000128204 CCCGTACATTATGAAGACATT pLKO.1 769 CDS 100% 4.950 3.465 N CCDC174 n/a
10 TRCN0000129769 CTGGATGACATGATTTCCTAT pLKO.1 1441 CDS 100% 4.950 3.465 N CCDC174 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016474.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11966 pDONR223 100% 79.6% 79.6% None 1_285del n/a
2 ccsbBroad304_11966 pLX_304 0% 79.6% 79.6% V5 1_285del n/a
3 TRCN0000468858 TTAGCCAATTTTATCCTCATCGAC pLX_317 6% 79.6% 79.6% V5 1_285del n/a
Download CSV