Transcript: Human NM_016599.5

Homo sapiens myozenin 2 (MYOZ2), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
MYOZ2 (51778)
Length:
2549
CDS:
166..960

Additional Resources:

NCBI RefSeq record:
NM_016599.5
NBCI Gene record:
MYOZ2 (51778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016599.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419772 TCACTTGTCTTCATTCATAAT pLKO_005 1160 3UTR 100% 13.200 18.480 N MYOZ2 n/a
2 TRCN0000433790 GCCTGATTACAGGAGCTTTAA pLKO_005 702 CDS 100% 13.200 9.240 N MYOZ2 n/a
3 TRCN0000152170 CAGGTTTATGTCCTTTGTCAA pLKO.1 816 CDS 100% 4.950 3.465 N MYOZ2 n/a
4 TRCN0000151919 CCCAGAAAGTAACAATGACAA pLKO.1 2319 3UTR 100% 4.950 3.465 N MYOZ2 n/a
5 TRCN0000152336 CCTGGTTTAAAGAATCCAGAT pLKO.1 1191 3UTR 100% 4.050 2.835 N MYOZ2 n/a
6 TRCN0000152923 CCAGTATCAATCTAGAGCACA pLKO.1 384 CDS 100% 2.640 1.848 N MYOZ2 n/a
7 TRCN0000155144 GCCAGGCTATTTAAGATGCGT pLKO.1 328 CDS 100% 0.750 0.525 N MYOZ2 n/a
8 TRCN0000151099 GTCCTTTAATAGGACTCCTAA pLKO.1 855 CDS 100% 0.495 0.347 N MYOZ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016599.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03383 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03383 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491345 TACATGACAATGTCCTTATCGTGT pLX_317 35% 100% 100% V5 n/a
4 ccsbBroadEn_15857 pDONR223 0% 99.8% 100% None 237A>G n/a
5 ccsbBroad304_15857 pLX_304 0% 99.8% 100% V5 237A>G n/a
6 TRCN0000480033 GAATAAAAGGAACACGTGTTTGCG pLX_317 45.4% 99.8% 100% V5 237A>G n/a
Download CSV