Transcript: Human NM_016617.4

Homo sapiens ubiquitin fold modifier 1 (UFM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
UFM1 (51569)
Length:
3168
CDS:
70..327

Additional Resources:

NCBI RefSeq record:
NM_016617.4
NBCI Gene record:
UFM1 (51569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016617.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037005 CTGCGGATTATTCCTAGAGAT pLKO.1 289 CDS 100% 4.950 6.930 N UFM1 n/a
2 TRCN0000037006 GTGTTCCTGAAAGTACACCTT pLKO.1 134 CDS 100% 2.640 3.696 N UFM1 n/a
3 TRCN0000037008 GCAGTCTTAAAGTTTGCAGCA pLKO.1 160 CDS 100% 2.160 3.024 N UFM1 n/a
4 TRCN0000232598 TGGTTCAGAACTGCGGATTAT pLKO_005 279 CDS 100% 13.200 10.560 N UFM1 n/a
5 TRCN0000257386 ACGAAATCAAAGCCCATTAAT pLKO_005 1615 3UTR 100% 15.000 10.500 N UFM1 n/a
6 TRCN0000232597 CAATGATGGAATAGGAATAAA pLKO_005 222 CDS 100% 15.000 10.500 N UFM1 n/a
7 TRCN0000257358 CACCTTTCACAGCAGTCTTAA pLKO_005 149 CDS 100% 13.200 9.240 N UFM1 n/a
8 TRCN0000037004 CCAATGATGGAATAGGAATAA pLKO.1 221 CDS 100% 13.200 9.240 N UFM1 n/a
9 TRCN0000232599 GTGTTGGAAGTTGTTAATATC pLKO_005 311 CDS 100% 13.200 7.920 N UFM1 n/a
10 TRCN0000037007 CCTGCTGCAACAAGTGCAATT pLKO.1 196 CDS 100% 10.800 6.480 N UFM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016617.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08322 pDONR223 100% 99.6% 100% None 240T>C n/a
2 ccsbBroad304_08322 pLX_304 0% 99.6% 100% V5 240T>C n/a
3 TRCN0000474616 CTGAGTTCGTTCGTCTTATCAGGC pLX_317 100% 99.6% 100% V5 240T>C n/a
Download CSV