Transcript: Human NM_016618.3

Homo sapiens lysine rich coiled-coil 1 (KRCC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
KRCC1 (51315)
Length:
1807
CDS:
449..1228

Additional Resources:

NCBI RefSeq record:
NM_016618.3
NBCI Gene record:
KRCC1 (51315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016618.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143774 GCGGTCTAAGCATAAGAGAAA pLKO.1 970 CDS 100% 4.950 6.930 N KRCC1 n/a
2 TRCN0000142824 CAAGCACTTCTCCTCAGATAA pLKO.1 859 CDS 100% 13.200 9.240 N KRCC1 n/a
3 TRCN0000343766 CAAGCACTTCTCCTCAGATAA pLKO_005 859 CDS 100% 13.200 9.240 N KRCC1 n/a
4 TRCN0000122575 CCTACCCAAGATCATGCAATA pLKO.1 657 CDS 100% 10.800 7.560 N KRCC1 n/a
5 TRCN0000144798 GACCAGTCTATTCTTGGATTT pLKO.1 1205 CDS 100% 10.800 7.560 N KRCC1 n/a
6 TRCN0000216463 GACCAGTCTATTCTTGGATTT pLKO.1 1205 CDS 100% 10.800 7.560 N Krcc1 n/a
7 TRCN0000343768 GACCAGTCTATTCTTGGATTT pLKO_005 1205 CDS 100% 10.800 7.560 N KRCC1 n/a
8 TRCN0000144361 CCTTTGCACAATCTGTTTCTT pLKO.1 1552 3UTR 100% 5.625 3.938 N KRCC1 n/a
9 TRCN0000343770 CCTTTGCACAATCTGTTTCTT pLKO_005 1552 3UTR 100% 5.625 3.938 N KRCC1 n/a
10 TRCN0000145111 GTGGAAATAGAAACCGTACAT pLKO.1 1052 CDS 100% 4.950 3.465 N KRCC1 n/a
11 TRCN0000343767 GTGGAAATAGAAACCGTACAT pLKO_005 1052 CDS 100% 4.950 3.465 N KRCC1 n/a
12 TRCN0000145370 GCTTAAGAATCGAAAGGAGAA pLKO.1 1087 CDS 100% 4.050 2.835 N KRCC1 n/a
13 TRCN0000122666 GACCTACCCAAGATCATGCAA pLKO.1 655 CDS 100% 3.000 2.100 N KRCC1 n/a
14 TRCN0000144251 CAAATTGCTTTGATGGTGGAA pLKO.1 1484 3UTR 100% 2.640 1.848 N KRCC1 n/a
15 TRCN0000140007 GAGACTAGACTCTCTGAGCTA pLKO.1 736 CDS 100% 2.640 1.848 N KRCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016618.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03281 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03281 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465290 CTCATCTTCGCTGTGGTCCTGTTG pLX_317 45.7% 100% 100% V5 n/a
Download CSV