Transcript: Mouse NM_016719.1

Mus musculus growth factor receptor bound protein 14 (Grb14), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Grb14 (50915)
Length:
1978
CDS:
123..1739

Additional Resources:

NCBI RefSeq record:
NM_016719.1
NBCI Gene record:
Grb14 (50915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016719.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097179 CCAAACTGTGTGTCACTCGTT pLKO.1 1740 CDS 100% 2.640 2.112 N Grb14 n/a
2 TRCN0000313736 AGGAAGAAGCAGGTGATTAAA pLKO_005 429 CDS 100% 15.000 10.500 N Grb14 n/a
3 TRCN0000349929 GGATGCAAAGGAGAATGATTA pLKO_005 1778 3UTR 100% 13.200 9.240 N Grb14 n/a
4 TRCN0000097182 TCCCTATGGATTCTGCTTAAA pLKO.1 1022 CDS 100% 13.200 9.240 N Grb14 n/a
5 TRCN0000097180 CTCCCTATGGATTCTGCTTAA pLKO.1 1021 CDS 100% 10.800 7.560 N Grb14 n/a
6 TRCN0000317251 CTCCCTATGGATTCTGCTTAA pLKO_005 1021 CDS 100% 10.800 7.560 N Grb14 n/a
7 TRCN0000313737 TCCAAGGAACCACGGCATTTG pLKO_005 927 CDS 100% 10.800 7.560 N Grb14 n/a
8 TRCN0000097183 CACCTATCTCACATAGGTTTA pLKO.1 576 CDS 100% 1.080 0.756 N Grb14 n/a
9 TRCN0000317250 CACCTATCTCACATAGGTTTA pLKO_005 576 CDS 100% 1.080 0.756 N Grb14 n/a
10 TRCN0000097181 GCACCTATCTCACATAGGTTT pLKO.1 575 CDS 100% 0.495 0.347 N Grb14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016719.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478548 GGTTAAGATAAAGCCTCCCTTCAA pLX_317 25.3% 85% 85.7% V5 (many diffs) n/a
2 ccsbBroadEn_06325 pDONR223 100% 85% 85.7% None (many diffs) n/a
3 ccsbBroad304_06325 pLX_304 0% 85% 85.7% V5 (many diffs) n/a
Download CSV