Transcript: Mouse NM_016759.4

Mus musculus RUN domain containing 3A (Rundc3a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rundc3a (51799)
Length:
2430
CDS:
274..1614

Additional Resources:

NCBI RefSeq record:
NM_016759.4
NBCI Gene record:
Rundc3a (51799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016759.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106094 CGATTACACACCCTACCTAAA pLKO.1 870 CDS 100% 10.800 15.120 N Rundc3a n/a
2 TRCN0000316841 CGATTACACACCCTACCTAAA pLKO_005 870 CDS 100% 10.800 15.120 N Rundc3a n/a
3 TRCN0000106093 GCCAGCAACTCCAAGCTATAT pLKO.1 1339 CDS 100% 13.200 9.240 N Rundc3a n/a
4 TRCN0000106090 CCTGGTTCCTTCTGATTTCTT pLKO.1 1883 3UTR 100% 5.625 3.938 N Rundc3a n/a
5 TRCN0000316774 CCTGGTTCCTTCTGATTTCTT pLKO_005 1883 3UTR 100% 5.625 3.938 N Rundc3a n/a
6 TRCN0000106092 GAAGCGTATGTCGGAATACAT pLKO.1 678 CDS 100% 5.625 3.938 N Rundc3a n/a
7 TRCN0000316843 GAAGCGTATGTCGGAATACAT pLKO_005 678 CDS 100% 5.625 3.938 N Rundc3a n/a
8 TRCN0000106091 CGATGAAGACAGTTGGTACAA pLKO.1 999 CDS 100% 4.950 3.465 N Rundc3a n/a
9 TRCN0000316775 CGATGAAGACAGTTGGTACAA pLKO_005 999 CDS 100% 4.950 3.465 N Rundc3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016759.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07701 pDONR223 100% 81.5% 86.1% None (many diffs) n/a
2 ccsbBroad304_07701 pLX_304 0% 81.5% 86.1% V5 (many diffs) n/a
3 TRCN0000467002 GGTTATATTCTAATGCGACATACC pLX_317 35.8% 81.5% 86.1% V5 (many diffs) n/a
Download CSV