Transcript: Mouse NM_016768.2

Mus musculus pre B cell leukemia homeobox 3 (Pbx3), transcript variant a, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pbx3 (18516)
Length:
2870
CDS:
126..1430

Additional Resources:

NCBI RefSeq record:
NM_016768.2
NBCI Gene record:
Pbx3 (18516)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075383 GCCATCTCTTATGTTGTAATT pLKO.1 1932 3UTR 100% 13.200 18.480 N Pbx3 n/a
2 TRCN0000333921 GCCATCTCTTATGTTGTAATT pLKO_005 1932 3UTR 100% 13.200 18.480 N Pbx3 n/a
3 TRCN0000018897 GCTAATGAGACTGGACAATAT pLKO.1 446 CDS 100% 13.200 18.480 N PBX3 n/a
4 TRCN0000075384 CCACATAACTTAAACGCTAAT pLKO.1 1323 CDS 100% 10.800 15.120 N Pbx3 n/a
5 TRCN0000333999 CCACATAACTTAAACGCTAAT pLKO_005 1323 CDS 100% 10.800 15.120 N Pbx3 n/a
6 TRCN0000018895 GCGAACTCATACAAACCAATA pLKO.1 2243 3UTR 100% 10.800 15.120 N PBX3 n/a
7 TRCN0000075387 GCACTCGGATACCTCTAACTA pLKO.1 1409 CDS 100% 5.625 7.875 N Pbx3 n/a
8 TRCN0000334000 GCACTCGGATACCTCTAACTA pLKO_005 1409 CDS 100% 5.625 7.875 N Pbx3 n/a
9 TRCN0000018899 CACACAGAACTGGAGAAATAT pLKO.1 615 CDS 100% 15.000 10.500 N PBX3 n/a
10 TRCN0000234313 ACTCGGATACCTCTAACTAAT pLKO_005 1411 CDS 100% 13.200 9.240 N PBX3 n/a
11 TRCN0000218305 AGCTAATGAGACTGGACAATA pLKO_005 445 CDS 100% 13.200 9.240 N PBX3 n/a
12 TRCN0000075385 CGTGTGAAGCAGTTATGATTT pLKO.1 787 CDS 100% 13.200 9.240 N Pbx3 n/a
13 TRCN0000333919 CGTGTGAAGCAGTTATGATTT pLKO_005 787 CDS 100% 13.200 9.240 N Pbx3 n/a
14 TRCN0000234311 GGTTCTTCAGATAACTCTATT pLKO_005 546 CDS 100% 13.200 9.240 N PBX3 n/a
15 TRCN0000018898 CAAACGAATCAGGTACAAGAA pLKO.1 989 CDS 100% 4.950 3.465 N PBX3 n/a
16 TRCN0000075386 ACTCTATTGAACACTCAGATT pLKO.1 559 CDS 100% 4.950 2.970 N Pbx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11017 pDONR223 100% 52.6% 55.3% None (many diffs) n/a
2 ccsbBroad304_11017 pLX_304 0% 52.6% 55.3% V5 (many diffs) n/a
3 TRCN0000473112 AAAGCGGGCGCATTTGCAGTCACT pLX_317 40.2% 52.6% 55.3% V5 (many diffs) n/a
Download CSV