Transcript: Mouse NM_016860.1

Mus musculus ARP1 actin-related protein 1A, centractin alpha (Actr1a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Actr1a (54130)
Length:
2742
CDS:
59..1189

Additional Resources:

NCBI RefSeq record:
NM_016860.1
NBCI Gene record:
Actr1a (54130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016860.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090916 ACCCATGCAGTCCCGATTTAT pLKO.1 551 CDS 100% 15.000 21.000 N Actr1a n/a
2 TRCN0000315603 ACCCATGCAGTCCCGATTTAT pLKO_005 551 CDS 100% 15.000 21.000 N Actr1a n/a
3 TRCN0000090913 CCTTGCTTACACTAATGTTTA pLKO.1 1993 3UTR 100% 13.200 18.480 N Actr1a n/a
4 TRCN0000090917 CGATTTATGAAGGCTTCGCCA pLKO.1 564 CDS 100% 0.660 0.924 N Actr1a n/a
5 TRCN0000330729 TGAAGTTAACTCCACTTTAAA pLKO_005 1214 3UTR 100% 15.000 12.000 N ACTR1A n/a
6 TRCN0000353696 CAACGGATCCGGTGTGATTAA pLKO_005 103 CDS 100% 13.200 10.560 N ACTR1A n/a
7 TRCN0000090914 GCCCGATCCATCCACAGGAAA pLKO.1 1160 CDS 100% 1.650 1.320 N Actr1a n/a
8 TRCN0000309137 GCCCGATCCATCCACAGGAAA pLKO_005 1160 CDS 100% 1.650 1.320 N Actr1a n/a
9 TRCN0000090915 CAGAAGTCAGACATGGATTTA pLKO.1 908 CDS 100% 13.200 9.240 N Actr1a n/a
10 TRCN0000309071 CAGAAGTCAGACATGGATTTA pLKO_005 908 CDS 100% 13.200 9.240 N Actr1a n/a
11 TRCN0000374697 GAGATTGTCAAGGCCATAAAG pLKO_005 692 CDS 100% 13.200 9.240 N Actr1a n/a
12 TRCN0000330802 TGAGATTGTCAAGGCCATAAA pLKO_005 691 CDS 100% 13.200 9.240 N ACTR1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016860.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02320 pDONR223 100% 91.4% 100% None (many diffs) n/a
2 ccsbBroad304_02320 pLX_304 0% 91.4% 100% V5 (many diffs) n/a
3 TRCN0000465939 CCTATTAGCTTAATGCGATACTAC pLX_317 33.4% 91.4% 100% V5 (many diffs) n/a
4 ccsbBroadEn_07555 pDONR223 100% 79.7% 90.4% None (many diffs) n/a
5 ccsbBroad304_07555 pLX_304 0% 79.7% 90.4% V5 (many diffs) n/a
6 TRCN0000465969 GCCACCGGCCCCGTCGATTCAGTA pLX_317 38.1% 79.7% 90.4% V5 (many diffs) n/a
7 ccsbBroadEn_07554 pDONR223 100% 79.6% 90.1% None (many diffs) n/a
8 ccsbBroad304_07554 pLX_304 0% 79.6% 90.1% V5 (many diffs) n/a
9 TRCN0000471351 ATAATAAATACATTTACAGATCGA pLX_317 45.1% 79.6% 90.1% V5 (many diffs) n/a
Download CSV