Transcript: Mouse NM_016861.4

Mus musculus PDZ and LIM domain 1 (elfin) (Pdlim1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pdlim1 (54132)
Length:
1524
CDS:
176..1159

Additional Resources:

NCBI RefSeq record:
NM_016861.4
NBCI Gene record:
Pdlim1 (54132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016861.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085290 CATCCCTACAAGATGAATTTA pLKO.1 473 CDS 100% 15.000 21.000 N Pdlim1 n/a
2 TRCN0000418948 ACCGAAGTGCCATGCCATTTA pLKO_005 537 CDS 100% 13.200 18.480 N Pdlim1 n/a
3 TRCN0000085289 GCGAATTTATGTATTGGAGAT pLKO.1 299 CDS 100% 4.050 5.670 N Pdlim1 n/a
4 TRCN0000085291 CGTCATCCCTACAAGATGAAT pLKO.1 470 CDS 100% 0.563 0.450 N Pdlim1 n/a
5 TRCN0000419894 ACAAATGTGGAACTGGTATTG pLKO_005 951 CDS 100% 10.800 7.560 N Pdlim1 n/a
6 TRCN0000085292 TCGAACAACCTCTCGCCATTT pLKO.1 246 CDS 100% 10.800 7.560 N Pdlim1 n/a
7 TRCN0000161848 GAAACAGAAGGGCCATTTCTT pLKO.1 1048 CDS 100% 5.625 3.938 N PDLIM1 n/a
8 TRCN0000085288 GTCCTGTGCTTACTTAGTGTT pLKO.1 1245 3UTR 100% 4.950 3.465 N Pdlim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016861.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02086 pDONR223 100% 86.9% 88.7% None (many diffs) n/a
2 ccsbBroad304_02086 pLX_304 0% 86.9% 88.7% V5 (many diffs) n/a
3 TRCN0000481128 GAGTCATCTCGAAACACTTTATCC pLX_317 44.9% 86.9% 88.7% V5 (many diffs) n/a
Download CSV