Transcript: Mouse NM_016862.4

Mus musculus vesicle transport through interaction with t-SNAREs 1A (Vti1a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Vti1a (53611)
Length:
4599
CDS:
395..1048

Additional Resources:

NCBI RefSeq record:
NM_016862.4
NBCI Gene record:
Vti1a (53611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381756 GGTTGGTCTTTGCCCAGATTT pLKO_005 1247 3UTR 100% 13.200 10.560 N Vti1a n/a
2 TRCN0000235559 ATCGCCTACAGTGACGAAGTA pLKO_005 671 CDS 100% 4.950 3.960 N Vti1a n/a
3 TRCN0000379908 GGAAGAGCTCTCGGATTCTGA pLKO_005 918 CDS 100% 3.000 2.400 N Vti1a n/a
4 TRCN0000235560 GAGAAGCTACAAGCAAGAAAT pLKO_005 616 CDS 100% 13.200 9.240 N Vti1a n/a
5 TRCN0000381109 GCTGAGTGCAGAGAGTGTAAA pLKO_005 1180 3UTR 100% 13.200 9.240 N Vti1a n/a
6 TRCN0000235561 GGATTTGGAAGTTCGAGAAAT pLKO_005 559 CDS 100% 13.200 9.240 N Vti1a n/a
7 TRCN0000235558 TCTTGGCTTGTTCCGAGTAAT pLKO_005 1078 3UTR 100% 13.200 9.240 N Vti1a n/a
8 TRCN0000380667 GAGGGCACATCTGCTGGATAA pLKO_005 736 CDS 100% 10.800 7.560 N Vti1a n/a
9 TRCN0000380711 GGTCACATGAATCATTCTTTC pLKO_005 1110 3UTR 100% 10.800 7.560 N Vti1a n/a
10 TRCN0000012175 GCTGAGATCACCAGCAAGATT pLKO.1 443 CDS 100% 5.625 3.938 N Vti1a n/a
11 TRCN0000381443 ACCGTATCCTGCTCGTCATCT pLKO_005 966 CDS 100% 4.950 3.465 N Vti1a n/a
12 TRCN0000012177 ACCTGAGTCATGACAGAGAAA pLKO.1 849 CDS 100% 4.950 3.465 N Vti1a n/a
13 TRCN0000380475 GAAAGGTCGTCTCGGAGACTA pLKO_005 770 CDS 100% 4.950 3.465 N Vti1a n/a
14 TRCN0000012176 GAACAGATGGATTTGGAAGTT pLKO.1 551 CDS 100% 4.950 3.465 N Vti1a n/a
15 TRCN0000012173 GCGTGAGAATTGGCACAGAAT pLKO.1 1833 3UTR 100% 4.950 3.465 N Vti1a n/a
16 TRCN0000380983 GGGATGCTGCGAAGAATCATC pLKO_005 941 CDS 100% 4.950 3.465 N Vti1a n/a
17 TRCN0000381671 GATCACCAGCAAGATTGCAAG pLKO_005 448 CDS 100% 4.050 2.835 N Vti1a n/a
18 TRCN0000012174 GCTGCGAAGAATCATCCAGAA pLKO.1 946 CDS 100% 4.050 2.835 N Vti1a n/a
19 TRCN0000381457 TTTCGTCAAAGGACACTGATG pLKO_005 1030 CDS 100% 4.050 2.835 N Vti1a n/a
20 TRCN0000381807 ACTCCGGGACGCAGATGCAAA pLKO_005 892 CDS 100% 1.650 1.155 N Vti1a n/a
21 TRCN0000235557 CCCAAAGTCGAGGAATGTATA pLKO_005 585 CDS 100% 13.200 7.920 N Vti1a n/a
22 TRCN0000382298 CATCGTGGTCATCGCCATCCT pLKO_005 994 CDS 100% 0.880 0.528 N Vti1a n/a
23 TRCN0000043360 GTGGAGAAACAGCTTGAAGAA pLKO.1 515 CDS 100% 4.950 3.465 N VTI1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.