Transcript: Mouse NM_016906.4

Mus musculus Sec61 alpha 1 subunit (S. cerevisiae) (Sec61a1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sec61a1 (53421)
Length:
3039
CDS:
109..1539

Additional Resources:

NCBI RefSeq record:
NM_016906.4
NBCI Gene record:
Sec61a1 (53421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016906.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295308 AGGCGCCATCATAGCGCTATT pLKO_005 738 CDS 100% 10.800 15.120 N Sec61a1 n/a
2 TRCN0000111596 CGGTCTTATCATGCAGCTCTT pLKO.1 369 CDS 100% 4.050 5.670 N Sec61a1 n/a
3 TRCN0000295242 TTTGCCGTTGTCATCTATTTC pLKO_005 862 CDS 100% 13.200 9.240 N Sec61a1 n/a
4 TRCN0000295243 TCTCTCTTCATTGCGACTAAC pLKO_005 646 CDS 100% 10.800 7.560 N Sec61a1 n/a
5 TRCN0000111597 CCAGAAGTTGTTTGGAATGAT pLKO.1 453 CDS 100% 5.625 3.938 N Sec61a1 n/a
6 TRCN0000287953 CCAGAAGTTGTTTGGAATGAT pLKO_005 453 CDS 100% 5.625 3.938 N Sec61a1 n/a
7 TRCN0000111599 CAAGCCATTCTGTGTCATCTT pLKO.1 135 CDS 100% 4.950 3.465 N Sec61a1 n/a
8 TRCN0000111595 CCTCAGTGGAAGTAGCAGAAT pLKO.1 2509 3UTR 100% 4.950 3.465 N Sec61a1 n/a
9 TRCN0000287880 CCTCAGTGGAAGTAGCAGAAT pLKO_005 2509 3UTR 100% 4.950 3.465 N Sec61a1 n/a
10 TRCN0000152969 GCTGGCTTAATTGTCCTACTT pLKO.1 580 CDS 100% 4.950 3.465 N SEC61A1 n/a
11 TRCN0000343600 GCTGGCTTAATTGTCCTACTT pLKO_005 580 CDS 100% 4.950 3.465 N SEC61A1 n/a
12 TRCN0000111598 CAGCTCTTTGTTGCTGGCTTA pLKO.1 568 CDS 100% 4.050 2.835 N Sec61a1 n/a
13 TRCN0000152334 CAGTACTTTGAGATCTTCGTT pLKO.1 1474 CDS 100% 3.000 2.100 N SEC61A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016906.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11912 pDONR223 100% 80% 88.8% None (many diffs) n/a
2 ccsbBroad304_11912 pLX_304 0% 80% 88.8% V5 (many diffs) n/a
3 TRCN0000471599 TACGTAAATATTTCTGGTATGGCC pLX_317 37.3% 80% 88.8% V5 (many diffs) n/a
Download CSV