Transcript: Mouse NM_016911.4

Mus musculus sushi-repeat-containing protein (Srpx), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Srpx (51795)
Length:
2456
CDS:
122..1516

Additional Resources:

NCBI RefSeq record:
NM_016911.4
NBCI Gene record:
Srpx (51795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016911.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201808 GCAGGATCAGAGCAAAGATTA pLKO.1 1284 CDS 100% 13.200 9.240 N Srpx n/a
2 TRCN0000190537 GCAGCGATGAATGTCAATGTT pLKO.1 1073 CDS 100% 5.625 3.938 N Srpx n/a
3 TRCN0000191673 GCTCCTCATCTCTTATTCTAT pLKO.1 1538 3UTR 100% 5.625 3.938 N Srpx n/a
4 TRCN0000201559 CCCAAGTGTGAAAGAACGTAT pLKO.1 673 CDS 100% 4.950 3.465 N Srpx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016911.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01922 pDONR223 100% 87.8% 92.7% None (many diffs) n/a
2 ccsbBroad304_01922 pLX_304 44.6% 87.8% 92.7% V5 (many diffs) n/a
3 TRCN0000479942 ACGGAATTTCCCAGGTCCCTTACA pLX_317 26.6% 87.8% 92.7% V5 (many diffs) n/a
Download CSV