Transcript: Human NM_016954.2

Homo sapiens T-box transcription factor 22 (TBX22), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TBX22 (50945)
Length:
2248
CDS:
28..1590

Additional Resources:

NCBI RefSeq record:
NM_016954.2
NBCI Gene record:
TBX22 (50945)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016954.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082067 CGGTGGATTCCAAACGCTATA pLKO.1 464 CDS 100% 10.800 15.120 N Tbx22 n/a
2 TRCN0000019172 CGGCAGATCATCAGCTTTGAT pLKO.1 598 CDS 100% 5.625 7.875 N TBX22 n/a
3 TRCN0000019173 GCACCTAATTCTACCAATCAA pLKO.1 1333 CDS 100% 5.625 7.875 N TBX22 n/a
4 TRCN0000019171 CCTGCCTCTATGCTACAAGAT pLKO.1 1131 CDS 100% 4.950 3.960 N TBX22 n/a
5 TRCN0000423885 TCGGGACTGAGATGATCATTA pLKO_005 350 CDS 100% 13.200 9.240 N TBX22 n/a
6 TRCN0000421356 TTGCCCACTGAAGGTGTTAAA pLKO_005 748 CDS 100% 13.200 9.240 N TBX22 n/a
7 TRCN0000019169 GCCTTCTTTCACTCTCGATTT pLKO.1 930 CDS 100% 10.800 7.560 N TBX22 n/a
8 TRCN0000019170 CGCATGAAACTCACCAACAAT pLKO.1 619 CDS 100% 5.625 3.938 N TBX22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016954.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03162 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03162 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467000 GAGTCGCTCCAGCTTCTTACAACA pLX_317 25.2% 100% 100% V5 n/a
Download CSV