Transcript: Human NM_017452.3

Homo sapiens staufen double-stranded RNA binding protein 1 (STAU1), transcript variant T2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
STAU1 (6780)
Length:
3425
CDS:
369..1859

Additional Resources:

NCBI RefSeq record:
NM_017452.3
NBCI Gene record:
STAU1 (6780)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161773 CAGTTGAACGAGTAAAGCCTA pLKO.1 895 CDS 100% 2.640 3.696 N STAU1 n/a
2 TRCN0000158514 CAAGTGTTTGAGATTGCACTT pLKO.1 687 CDS 100% 0.405 0.567 N STAU1 n/a
3 TRCN0000165442 GCCTGCAGTTGAACGAGTAAA pLKO.1 890 CDS 100% 13.200 10.560 N STAU1 n/a
4 TRCN0000219938 GAGGAGAAGACACCCATAAAG pLKO.1 1230 CDS 100% 13.200 9.240 N STAU1 n/a
5 TRCN0000159875 GTGTTTGAGATTGCACTTAAA pLKO.1 690 CDS 100% 13.200 9.240 N STAU1 n/a
6 TRCN0000219937 TCGGATGCAGTCCACCTATAA pLKO.1 416 CDS 100% 13.200 9.240 N STAU1 n/a
7 TRCN0000159567 CCAACAGTGATCTGTATTCTT pLKO.1 2422 3UTR 100% 5.625 3.938 N STAU1 n/a
8 TRCN0000166217 CCATCACCACTGCTTTCTCTT pLKO.1 2401 3UTR 100% 4.950 3.465 N STAU1 n/a
9 TRCN0000164920 GCTGAAACAGTCCTGGACTTT pLKO.1 2670 3UTR 100% 4.950 3.465 N STAU1 n/a
10 TRCN0000165690 CCAGGGATTCCAGGTTGAATA pLKO.1 1622 CDS 100% 13.200 7.920 N STAU1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01612 pDONR223 100% 85.9% 85.9% None 0_1ins243 n/a
2 ccsbBroad304_01612 pLX_304 0% 85.9% 85.9% V5 0_1ins243 n/a
3 TRCN0000491368 GTCATTTTCATGCAGCTTGACGAA pLX_317 19.9% 85.9% 85.9% V5 0_1ins243 n/a
Download CSV