Transcript: Mouse NM_017461.2

Mus musculus septin 1 (Sept1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sept1 (54204)
Length:
1466
CDS:
37..1137

Additional Resources:

NCBI RefSeq record:
NM_017461.2
NBCI Gene record:
Sept1 (54204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101793 ACCCACCTTCAGGACTTGAAA pLKO.1 847 CDS 100% 5.625 7.875 N Sept1 n/a
2 TRCN0000433113 ATCAGATGTGCTGTGATATTC pLKO_005 1122 CDS 100% 13.200 10.560 N Sept1 n/a
3 TRCN0000156806 GAACCCACATCACTGCGATTT pLKO.1 798 CDS 100% 10.800 8.640 N SEPTIN1 n/a
4 TRCN0000437358 CCTCCAATCCGGAAGTTTAAG pLKO_005 1266 3UTR 100% 13.200 9.240 N Sept1 n/a
5 TRCN0000417789 AGATCCGGGACCAGTTGAAAG pLKO_005 593 CDS 100% 10.800 7.560 N Sept1 n/a
6 TRCN0000101794 CGCTTCATTGAGGAGCAGTTT pLKO.1 358 CDS 100% 4.950 3.465 N Sept1 n/a
7 TRCN0000101792 GCAGTGCACGAGAAAGTCAAT pLKO.1 508 CDS 100% 4.950 3.465 N Sept1 n/a
8 TRCN0000424246 GATTCGCGAGAAGGACGAAGA pLKO_005 1029 CDS 100% 4.050 2.835 N Sept1 n/a
9 TRCN0000101790 GCCCTTGCACTTAAACCAGAT pLKO.1 1244 3UTR 100% 4.050 2.835 N Sept1 n/a
10 TRCN0000101791 CTCTACTTCATCTCACCCTTT pLKO.1 448 CDS 100% 4.050 2.430 N Sept1 n/a
11 TRCN0000157926 CCTCTACTTCATCTCACCCTT pLKO.1 447 CDS 100% 2.640 1.584 N SEPTIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00444 pDONR223 100% 88.4% 95.6% None (many diffs) n/a
2 ccsbBroad304_00444 pLX_304 0% 88.4% 95.6% V5 (many diffs) n/a
3 TRCN0000467119 CCTCTCCCACGGCCTAATGCTCAA pLX_317 34.1% 88.4% 95.6% V5 (many diffs) n/a
Download CSV