Transcript: Human NM_017545.3

Homo sapiens hydroxyacid oxidase 1 (HAO1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
HAO1 (54363)
Length:
1757
CDS:
37..1149

Additional Resources:

NCBI RefSeq record:
NM_017545.3
NBCI Gene record:
HAO1 (54363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017545.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046128 GCTGTTAAACATGGCTTGAAT pLKO.1 775 CDS 100% 5.625 7.875 N HAO1 n/a
2 TRCN0000046129 GCTGCAACTGTATATCTACAA pLKO.1 420 CDS 100% 4.950 6.930 N HAO1 n/a
3 TRCN0000046130 CGACAAGACATTGGTGAGGAA pLKO.1 1101 CDS 100% 2.640 3.696 N HAO1 n/a
4 TRCN0000416667 AGAGGGTCAGCATGCCAATAT pLKO_005 242 CDS 100% 13.200 10.560 N HAO1 n/a
5 TRCN0000423833 AGTACTTCCAAAGTCTATATA pLKO_005 87 CDS 100% 15.000 10.500 N HAO1 n/a
6 TRCN0000445301 GATCTGACAGTGCACAATATT pLKO_005 1143 CDS 100% 15.000 10.500 N Hao1 n/a
7 TRCN0000046131 GAAGAAACTTTGGCTGATAAT pLKO.1 136 CDS 100% 13.200 9.240 N HAO1 n/a
8 TRCN0000415627 AGGTTCAAAGTGTTGGTAATG pLKO_005 1564 3UTR 100% 10.800 7.560 N HAO1 n/a
9 TRCN0000046132 GCTGAGAAGACTGACATCATT pLKO.1 708 CDS 100% 5.625 3.938 N HAO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017545.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03412 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03412 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471719 GGATTGCCTGATCACACAGGATAC pLX_317 38.3% 100% 100% V5 n/a
Download CSV