Transcript: Human NM_017569.3

Homo sapiens SPT20 homolog, SAGA complex component (SUPT20H), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
SUPT20H (55578)
Length:
2981
CDS:
328..2529

Additional Resources:

NCBI RefSeq record:
NM_017569.3
NBCI Gene record:
SUPT20H (55578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018045 GCGGATGTGTCATAGCAGAAA pLKO.1 743 CDS 100% 4.950 6.930 N SUPT20H n/a
2 TRCN0000342932 GCGGATGTGTCATAGCAGAAA pLKO_005 743 CDS 100% 4.950 6.930 N SUPT20H n/a
3 TRCN0000219055 ATAGTTCCTCAGGTAACTATT pLKO_005 1751 CDS 100% 1.320 1.056 N Supt20 n/a
4 TRCN0000081526 CAGAAGAATTACCTCCTATTT pLKO.1 680 CDS 100% 13.200 9.240 N Supt20 n/a
5 TRCN0000018044 CCACAGATGATCATTCAAATT pLKO.1 1487 CDS 100% 13.200 9.240 N SUPT20H n/a
6 TRCN0000081524 GCAGAAGAATTACCTCCTATT pLKO.1 679 CDS 100% 10.800 7.560 N Supt20 n/a
7 TRCN0000018047 GCTTGTTATGCAAGAGACTTT pLKO.1 528 CDS 100% 4.950 3.465 N SUPT20H n/a
8 TRCN0000342998 GCTTGTTATGCAAGAGACTTT pLKO_005 528 CDS 100% 4.950 3.465 N SUPT20H n/a
9 TRCN0000018043 CCATCAAGTATTCCTCGGAAA pLKO.1 1831 CDS 100% 4.050 2.835 N SUPT20H n/a
10 TRCN0000342933 CCATCAAGTATTCCTCGGAAA pLKO_005 1831 CDS 100% 4.050 2.835 N SUPT20H n/a
11 TRCN0000018046 CCCACAACTTGTAGTCCTCAA pLKO.1 2287 CDS 100% 4.050 2.835 N SUPT20H n/a
12 TRCN0000342934 CCCACAACTTGTAGTCCTCAA pLKO_005 2287 CDS 100% 4.050 2.835 N SUPT20H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08547 pDONR223 100% 93.8% 90.3% None 164_166delAGC;2101_2102ins104;2199_2200ins37 n/a
2 ccsbBroad304_08547 pLX_304 0% 93.8% 90.3% V5 164_166delAGC;2101_2102ins104;2199_2200ins37 n/a
3 TRCN0000469326 GGACCCTGATTTTGCTTCTAACCA pLX_317 16.2% 93.8% 90.3% V5 164_166delAGC;2101_2102ins104;2199_2200ins37 n/a
Download CSV