Transcript: Human NM_017583.6

Homo sapiens tripartite motif containing 44 (TRIM44), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TRIM44 (54765)
Length:
12994
CDS:
338..1372

Additional Resources:

NCBI RefSeq record:
NM_017583.6
NBCI Gene record:
TRIM44 (54765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017583.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310220 GAGCAAGGTAGGGCCAAATTA pLKO_005 1816 3UTR 100% 15.000 21.000 N TRIM44 n/a
2 TRCN0000033852 GCTATGATCGAATTGGTGGAA pLKO.1 1034 CDS 100% 2.640 3.696 N TRIM44 n/a
3 TRCN0000033851 GCCGAAGAAGACAACCAAGAA pLKO.1 758 CDS 100% 4.950 3.960 N TRIM44 n/a
4 TRCN0000289901 GCCGAAGAAGACAACCAAGAA pLKO_005 758 CDS 100% 4.950 3.960 N TRIM44 n/a
5 TRCN0000296432 GGCTTGATTTGAGTACCTATT pLKO_005 885 CDS 100% 10.800 7.560 N TRIM44 n/a
6 TRCN0000033850 CCAGTGAAGAAGAGGACACAT pLKO.1 1350 CDS 100% 4.950 3.465 N TRIM44 n/a
7 TRCN0000289975 CCAGTGAAGAAGAGGACACAT pLKO_005 1350 CDS 100% 4.950 3.465 N TRIM44 n/a
8 TRCN0000033853 CCGAGGAAGTGTGCCGAGAAT pLKO.1 423 CDS 100% 1.650 1.155 N TRIM44 n/a
9 TRCN0000033849 CGGGACCAAATGAAGATGTTT pLKO.1 1091 CDS 100% 5.625 3.375 N TRIM44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017583.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08408 pDONR223 100% 99.9% 100% None 879T>G n/a
2 ccsbBroad304_08408 pLX_304 0% 99.9% 100% V5 879T>G n/a
3 TRCN0000469145 GTTTAAAAACTTCCCGTATGGTTC pLX_317 36.5% 99.9% 100% V5 879T>G n/a
Download CSV