Transcript: Human NM_017621.4

Homo sapiens alkB homolog 4, lysine demethylase (ALKBH4), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ALKBH4 (54784)
Length:
2092
CDS:
28..936

Additional Resources:

NCBI RefSeq record:
NM_017621.4
NBCI Gene record:
ALKBH4 (54784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017621.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219993 GACTGATCCCGGGATTGAAAT pLKO.1 960 3UTR 100% 13.200 18.480 N ALKBH4 n/a
2 TRCN0000162671 CTTTCGGAAACAGAAGCTAAA pLKO.1 369 CDS 100% 10.800 7.560 N ALKBH4 n/a
3 TRCN0000164523 CCAAAGTCAACTTTCGGAAAC pLKO.1 359 CDS 100% 6.000 4.200 N ALKBH4 n/a
4 TRCN0000165627 GATGCTGATCGAGGACTTTGT pLKO.1 246 CDS 100% 4.950 3.465 N ALKBH4 n/a
5 TRCN0000165212 GTGATGCTGATCGAGGACTTT pLKO.1 244 CDS 100% 4.950 3.465 N ALKBH4 n/a
6 TRCN0000164468 CCCAAAGTCAACTTTCGGAAA pLKO.1 358 CDS 100% 4.050 2.835 N ALKBH4 n/a
7 TRCN0000219992 CCTTGGTGGACAGCGTGATAG pLKO.1 665 CDS 100% 3.600 2.520 N ALKBH4 n/a
8 TRCN0000162098 CATACCGTTTCATTTACTGCT pLKO.1 155 CDS 100% 2.640 1.848 N ALKBH4 n/a
9 TRCN0000163367 GAAACAGAAGCTAAAGACCGA pLKO.1 375 CDS 100% 0.660 0.462 N ALKBH4 n/a
10 TRCN0000165425 GATCACTTGATGCCAGGAGTT pLKO.1 1260 3UTR 100% 4.050 2.025 Y ALKBH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017621.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03458 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03458 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469875 CCTATCCCCATCGTTGGACGAACT pLX_317 40.6% 100% 100% V5 n/a
Download CSV