Transcript: Human NM_017623.5

Homo sapiens cyclin and CBS domain divalent metal cation transport mediator 3 (CNNM3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CNNM3 (26505)
Length:
4900
CDS:
11..2134

Additional Resources:

NCBI RefSeq record:
NM_017623.5
NBCI Gene record:
CNNM3 (26505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017623.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045222 GCCGGTGGATTACTTCATTCT pLKO.1 1669 CDS 100% 4.950 6.930 N CNNM3 n/a
2 TRCN0000045218 GCACGCATTCATCTGCGTATT pLKO.1 1863 CDS 100% 1.080 1.512 N CNNM3 n/a
3 TRCN0000045219 GAGGGTCTGAAGTTTGAGAAT pLKO.1 1727 CDS 100% 4.950 3.465 N CNNM3 n/a
4 TRCN0000045220 CTTCGTCTTCAACGACACCAA pLKO.1 1183 CDS 100% 2.640 1.848 N CNNM3 n/a
5 TRCN0000045221 AGGTGTCTGATGATGAATATA pLKO.1 1455 CDS 100% 15.000 9.000 N CNNM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017623.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470877 GCCCTTTAGGCACCTCGCCTTCAT pLX_317 21% 99.9% 100% V5 894C>T n/a
2 ccsbBroadEn_15784 pDONR223 0% 45.4% 44.3% None (many diffs) n/a
3 ccsbBroad304_15784 pLX_304 0% 45.4% 44.3% V5 (many diffs) n/a
4 TRCN0000471412 ATTGACTTGCACAAAAGTTAACAC pLX_317 27% 45.4% 44.3% V5 (many diffs) n/a
Download CSV