Construct: ORF TRCN0000471412
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017547.1_s317c1
- Derived from:
- ccsbBroadEn_15784
- DNA Barcode:
- ATTGACTTGCACAAAAGTTAACAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CNNM3 (26505)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471412
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26505 | CNNM3 | cyclin and CBS domain dival... | NM_199078.3 | 48.7% | 47.5% | (many diffs) |
| 2 | human | 26505 | CNNM3 | cyclin and CBS domain dival... | NM_017623.5 | 45.4% | 44.3% | (many diffs) |
| 3 | human | 26505 | CNNM3 | cyclin and CBS domain dival... | XM_017003800.2 | 44.6% | 43.8% | (many diffs) |
| 4 | human | 26505 | CNNM3 | cyclin and CBS domain dival... | XM_011510957.3 | 43.8% | 43.5% | (many diffs) |
| 5 | human | 26505 | CNNM3 | cyclin and CBS domain dival... | XR_001738700.2 | 22.6% | (many diffs) | |
| 6 | human | 26505 | CNNM3 | cyclin and CBS domain dival... | XR_244887.5 | 22% | (many diffs) | |
| 7 | human | 26505 | CNNM3 | cyclin and CBS domain dival... | XR_001738701.2 | 20.7% | (many diffs) | |
| 8 | human | 26505 | CNNM3 | cyclin and CBS domain dival... | XR_001738702.2 | 15.9% | (many diffs) | |
| 9 | mouse | 94218 | Cnnm3 | cyclin M3 | NM_001331209.1 | 39.5% | 38.8% | (many diffs) |
| 10 | mouse | 94218 | Cnnm3 | cyclin M3 | NM_053186.3 | 39.5% | 38.9% | (many diffs) |
| 11 | mouse | 94218 | Cnnm3 | cyclin M3 | NM_001039551.2 | 39% | 38.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1131
- ORF length:
- 1065
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ggacgccagc accgtgctgg acttcggcgt cctggccagc atcatgcaga 121 gcggccacac gcgcatcccg gtgtacgagg aggagcgctc caacatcgtg gacatgctct 181 acctcaagga cttggccttc gtggatcccg aagactgcac gccgctcagc accatcactc 241 gtttctacaa ccatccgctc cacttcgtct tcaacgacac caagctggac gctgtcctgg 301 aggaattcaa gcgaggagac accgtggtga agaggaagcc tgcttctctg atggcccctc 361 tgaagcggaa ggaggagttc tccttgttca aggtgtctga tgatgaatat aaagtaacaa 421 tctcgcctca gctgctcttg gccacccagc gcttcctgtc ccgagaagtg gatgtattca 481 gcccgctgcg catctctgag aaggtcctgc tgcacctgtt gaagcatccc agtgtcaacc 541 aggaagtgag gtttgacgag agcaaccggc tggccacaca ccactacctg taccagcgca 601 gccagccggt ggattacttc attctcatcc tgcagggcag ggttgaagtg gagatcggga 661 aagagggtct gaagtttgag aatggggcct tcacgtacta tggagtgtcg gccctaactg 721 tgccatcctc ggttcaccag tccccggtgt cctcgctcca gcccatccgc catgacctgc 781 agcccgaccc aggtgacggc acgcattcat ctgcgtattg tcccgactac accgtgaggg 841 cgctctcTGA TCTGCAGCTC ATCAAGGTTA CGCGACTGCA GTACCTCAAT GCACTCCTGG 901 CTACCCGAGC CCAGAACCTG CCACAGTCCC CTGAGAACAC CGACCTGCAG GTTATTCCAG 961 GCAGCCAGAC CAGGCTCCTT GGTGAGAAGA CCACCACAGC GGCAGGGTCC AGCCACAGCA 1021 GGCCCAGCCT TCCCCTTCTC CCCCGGGGCA GGGACAGTGC GGCATATTCA GATTCAGACC 1081 TCTTTGGGCT GAGCCACCTT GTGAGTGCAG TTACTGCCTT TGTGTGGCCG TGCCCAACTT 1141 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1201 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1261 CTTGTGGAAA GGACGAATTG ACTTGCACAA AAGTTAACAC ACGCGTTAAG TCgacaatca 1321 acctctggat tacaaaattt gtgaaagatt