Transcript: Human NM_017655.6

Homo sapiens GIPC PDZ domain containing family member 2 (GIPC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GIPC2 (54810)
Length:
3778
CDS:
130..1077

Additional Resources:

NCBI RefSeq record:
NM_017655.6
NBCI Gene record:
GIPC2 (54810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017655.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428820 ACTAGGATTGGAGTATGATTT pLKO_005 1454 3UTR 100% 13.200 18.480 N GIPC2 n/a
2 TRCN0000159782 GCTGGATTATTGCTTAGATAA pLKO.1 2344 3UTR 100% 13.200 18.480 N GIPC2 n/a
3 TRCN0000160986 GATGCCAAACGAAGAGGATTA pLKO.1 1054 CDS 100% 10.800 15.120 N GIPC2 n/a
4 TRCN0000161748 CTTGGTCTCACCATTACAGAT pLKO.1 508 CDS 100% 4.950 6.930 N GIPC2 n/a
5 TRCN0000160445 CCTAAGAAGGCATTTGAAATA pLKO.1 721 CDS 100% 13.200 9.240 N GIPC2 n/a
6 TRCN0000159619 GCTGGAAAGGACAAAGTAAAT pLKO.1 943 CDS 100% 13.200 9.240 N GIPC2 n/a
7 TRCN0000433448 TGCCAAACGAAGAGGATTATG pLKO_005 1056 CDS 100% 13.200 9.240 N GIPC2 n/a
8 TRCN0000159950 GCCAACTTTCTCTCTTTGTAA pLKO.1 1630 3UTR 100% 5.625 3.938 N GIPC2 n/a
9 TRCN0000159402 GCTTCTTTATACATGCTCTTA pLKO.1 1678 3UTR 100% 4.950 3.465 N GIPC2 n/a
10 TRCN0000159845 GCTGATATTCTTTGTCCGATT pLKO.1 2436 3UTR 100% 4.050 2.835 N GIPC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017655.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08411 pDONR223 100% 99.8% 99.6% None 617T>C n/a
2 ccsbBroad304_08411 pLX_304 0% 99.8% 99.6% V5 617T>C n/a
3 TRCN0000469263 CAGGATGACTGCGGTTACCCACAG pLX_317 36.2% 99.8% 99.6% V5 617T>C n/a
Download CSV