Transcript: Human NM_017673.7

Homo sapiens SWT1 RNA endoribonuclease homolog (SWT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SWT1 (54823)
Length:
3838
CDS:
158..2860

Additional Resources:

NCBI RefSeq record:
NM_017673.7
NBCI Gene record:
SWT1 (54823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017673.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138589 CCCAGGGTACAGTATTAGCAT pLKO.1 3190 3UTR 100% 3.000 4.200 N SWT1 n/a
2 TRCN0000138437 CGGACTGTTCATGAGTGGAAA pLKO.1 1040 CDS 100% 4.950 3.960 N SWT1 n/a
3 TRCN0000416204 ACAGATGTTCTGTACTATAAT pLKO_005 335 CDS 100% 15.000 10.500 N SWT1 n/a
4 TRCN0000425990 ATGCTCAACTATAGGATATAA pLKO_005 2840 CDS 100% 15.000 10.500 N SWT1 n/a
5 TRCN0000416215 GGCTGTATTTGGATTAGTTAT pLKO_005 2056 CDS 100% 13.200 9.240 N SWT1 n/a
6 TRCN0000197672 CCTAATCAAGTATGAGGTAAA pLKO.1 2650 CDS 100% 10.800 7.560 N Swt1 n/a
7 TRCN0000134606 GATCAAGAGATGCAGATAGTA pLKO.1 1175 CDS 100% 5.625 3.938 N SWT1 n/a
8 TRCN0000135423 GCAGATCAAGAGATGCAGATA pLKO.1 1172 CDS 100% 4.950 3.465 N SWT1 n/a
9 TRCN0000134947 GCATCAAGAAATCTGGTCTAT pLKO.1 2410 CDS 100% 4.950 3.465 N SWT1 n/a
10 TRCN0000136152 GCCTATTACTGACAGTCTCAT pLKO.1 2992 3UTR 100% 4.950 3.465 N SWT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017673.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08414 pDONR223 100% 99.7% 99.5% None (many diffs) n/a
2 ccsbBroad304_08414 pLX_304 0% 99.7% 99.5% V5 (many diffs) n/a
3 TRCN0000477052 CCGCACTTGCACGAGTTAATTTTT pLX_317 16.1% 99.7% 99.5% V5 (many diffs) n/a
Download CSV