Transcript: Human NM_017829.5

Homo sapiens haloacid dehalogenase like hydrolase domain containing 5 (HDHD5), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
HDHD5 (27440)
Length:
1734
CDS:
44..1225

Additional Resources:

NCBI RefSeq record:
NM_017829.5
NBCI Gene record:
HDHD5 (27440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017829.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050203 GATAACCCTATGTCTGACGTA pLKO.1 890 CDS 100% 2.640 3.696 N HDHD5 n/a
2 TRCN0000333644 GATAACCCTATGTCTGACGTA pLKO_005 890 CDS 100% 2.640 3.696 N HDHD5 n/a
3 TRCN0000050207 CGAGACTTATGCTTCAGTCCA pLKO.1 1118 CDS 100% 2.640 2.112 N HDHD5 n/a
4 TRCN0000353150 CTGTGCCTGGAAACCATTTAC pLKO_005 722 CDS 100% 13.200 9.240 N HDHD5 n/a
5 TRCN0000353151 ACGTGGTGAATGACGTGAATG pLKO_005 1158 CDS 100% 10.800 7.560 N HDHD5 n/a
6 TRCN0000344867 TTTCCCTGCTGGGTAGCATTT pLKO_005 1395 3UTR 100% 10.800 7.560 N HDHD5 n/a
7 TRCN0000050204 AGGTGGATGCAGACCAAGTTA pLKO.1 282 CDS 100% 5.625 3.938 N HDHD5 n/a
8 TRCN0000333643 AGGTGGATGCAGACCAAGTTA pLKO_005 282 CDS 100% 5.625 3.938 N HDHD5 n/a
9 TRCN0000050205 CAAACCCAGCATCCTCACTTA pLKO.1 787 CDS 100% 4.950 3.465 N HDHD5 n/a
10 TRCN0000050206 TGTTACAAATGCTGGGAACAT pLKO.1 214 CDS 100% 4.950 3.465 N HDHD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017829.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.