Transcript: Human NM_018071.5

Homo sapiens Rho guanine nucleotide exchange factor 40 (ARHGEF40), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ARHGEF40 (55701)
Length:
5893
CDS:
94..4653

Additional Resources:

NCBI RefSeq record:
NM_018071.5
NBCI Gene record:
ARHGEF40 (55701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018071.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436386 TGGAACAGCTGACTCGGTATG pLKO_005 3716 CDS 100% 6.000 8.400 N ARHGEF40 n/a
2 TRCN0000136388 CGCTGAACACAACTCTTCATT pLKO.1 1793 CDS 100% 5.625 7.875 N ARHGEF40 n/a
3 TRCN0000418282 CACCTGGTTAAGGAGGAATAT pLKO_005 1378 CDS 100% 13.200 9.240 N ARHGEF40 n/a
4 TRCN0000134459 GCTGAACACAACTCTTCATTA pLKO.1 1794 CDS 100% 13.200 9.240 N ARHGEF40 n/a
5 TRCN0000433037 AGAAGGTGCTGGATATCTTTG pLKO_005 2645 CDS 100% 10.800 7.560 N ARHGEF40 n/a
6 TRCN0000135758 CCAACTGAACTCTGTGGATTT pLKO.1 1987 CDS 100% 10.800 7.560 N ARHGEF40 n/a
7 TRCN0000437757 GAGCTCATCTGTCCACGATTT pLKO_005 631 CDS 100% 10.800 7.560 N ARHGEF40 n/a
8 TRCN0000437114 GGATCTGGACGTCAAGCAAAT pLKO_005 4452 CDS 100% 10.800 7.560 N ARHGEF40 n/a
9 TRCN0000163368 GCCACATTGCTTGCCTTCATA pLKO.1 4865 3UTR 100% 5.625 3.938 N ARHGEF40 n/a
10 TRCN0000163309 GACACGCTGAACACAACTCTT pLKO.1 1789 CDS 100% 4.950 3.465 N ARHGEF40 n/a
11 TRCN0000161681 GCTGTCAGAGAATGATCTGAA pLKO.1 2022 CDS 100% 0.495 0.347 N ARHGEF40 n/a
12 TRCN0000423630 TGTTTACAAGCAGGCCTTTAA pLKO_005 4032 CDS 100% 13.200 7.920 N ARHGEF40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018071.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12256 pDONR223 100% 21.4% 21.4% None 1_3579del n/a
2 ccsbBroad304_12256 pLX_304 0% 21.4% 21.4% V5 1_3579del n/a
3 TRCN0000473647 CTTTGCAATACGACTTCTAGGTGT pLX_317 45.4% 21.4% 21.4% V5 1_3579del n/a
4 ccsbBroadEn_12257 pDONR223 98.6% 21.4% 21.3% None 1_3579del;4252A>C n/a
5 ccsbBroad304_12257 pLX_304 0% 21.4% 21.3% V5 (not translated due to prior stop codon) 1_3579del;4252A>C n/a
Download CSV