Construct: ORF TRCN0000473647
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015333.1_s317c1
- Derived from:
- ccsbBroadEn_12256
- DNA Barcode:
- CTTTGCAATACGACTTCTAGGTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGEF40 (55701)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473647
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | NM_001278529.2 | 40.4% | 40.4% | 1_1437del |
| 2 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | XM_017021435.2 | 40.2% | 40.2% | 1_1437del;2245_2256del |
| 3 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | XM_017021436.2 | 40.2% | 40.2% | 1_1437del;2245_2256del |
| 4 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | NM_001278530.2 | 34.5% | 34.5% | 1_1437del;2100_2101ins144 |
| 5 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | XM_017021437.2 | 34.5% | 34.5% | 1_1437del;2100_2101ins144 |
| 6 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | XM_017021434.2 | 24.4% | 24.4% | 1_3003del;3811_3822del |
| 7 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | NM_018071.5 | 21.4% | 21.4% | 1_3579del |
| 8 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | XM_011536937.3 | 21.4% | 21.4% | 1_3579del;4387_4398del |
| 9 | human | 55701 | ARHGEF40 | Rho guanine nucleotide exch... | XM_005267844.3 | 18.3% | 18.3% | 1_3579del;4242_4243ins144 |
| 10 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | NM_198249.4 | 19.2% | 20.2% | (many diffs) |
| 11 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | XM_006519044.3 | 19.2% | 20.2% | (many diffs) |
| 12 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | XM_006519041.3 | 19.1% | 20.1% | (many diffs) |
| 13 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | XM_006519042.3 | 19.1% | 20.1% | (many diffs) |
| 14 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | XM_006519045.2 | 19.1% | 20.1% | (many diffs) |
| 15 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | XM_017316026.1 | 19.1% | 20.1% | (many diffs) |
| 16 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | NM_001145922.1 | 16.2% | 17% | (many diffs) |
| 17 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | NM_001145921.1 | 16.1% | 16.9% | (many diffs) |
| 18 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | XM_006519046.2 | 16.1% | 16.9% | (many diffs) |
| 19 | mouse | 268739 | Arhgef40 | Rho guanine nucleotide exch... | XM_011245076.2 | 13.9% | 14.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1044
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggctggccct tacctgcccc gagccctgca gcagcctctg gaacagctga 121 ctcggtatgg gcggctcctg gaggagctcc tgagggaagc tgggcctgag ctcagttctg 181 agtgccgggc ccttggggct gctgtacagc tgctccggga acaagaggcc cgtggcagag 241 acctgctggc cgtggaggcg gtgcgtggct gtgagataga tctgaaggag cagggacagc 301 tcttgcatcg agaccccttc actgtcatct gtggccgaaa gaagtgcctt cgccatgtct 361 ttctcttcga gcatctcctc ctgttcagca agctcaaggg ccctgaaggg gggtcagaga 421 tgtttgttta caagcaggcc tttaagactg ctgatatggg gctgacagaa aacatcgggg 481 acagcggact ctgctttgag ttgtggtttc ggcggcggcg tgcacgagag gcatacactc 541 tgcaggcaac ctcaccagag atcaaactca agtggacaag ttctattgcc cagctgctgt 601 GGAGACAGGC AGCCCACAAC AAGGAGCTCC GAGTGCAGCA GATGGTGTCC ATGGGCATTG 661 GGAATAAACC CTTCCTGGAC ATCAAAGCCC TTGGGGAGCG GACGCTGAGT GCCCTGCTCA 721 CTGGAAGAGC CGCCCGCACC CGGGCCTCCG TGGCCGTGTC ATCCTTTGAG CATGCCGGCC 781 CCTCCCTTCC CGGCCTTTCG CCGGGAGCCT GCTCCCTGCC TGCCCGCGTC GAGGAGGAGG 841 CCTGGGATCT GGACGTCAAG CAAATTTCCC TGGCCCCAGA AACACTTGAC TCTTCTGGAG 901 ATGTGTCCCC AGGACCAAGA AACAGCCCCA GCCTGCAACC CCCCCACCCT GGGAGCAGCA 961 CTCCCACCCT GGCCAGTCGA GGGATCTTAG GGCTATCCCG ACAGAGTCAT GCTCGAGCCC 1021 TGAGTGACCC CACCACGCCT CTGTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1081 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1141 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC TTTGCAATAC 1201 GACTTCTAGG TGTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1261 att