Transcript: Human NM_018109.3

Homo sapiens mitochondrial poly(A) polymerase (MTPAP), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
MTPAP (55149)
Length:
5620
CDS:
64..1812

Additional Resources:

NCBI RefSeq record:
NM_018109.3
NBCI Gene record:
MTPAP (55149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160601 CGACCTTCCATATCAAGTAAT pLKO.1 1609 CDS 100% 13.200 18.480 N MTPAP n/a
2 TRCN0000160045 CGAAGTTCTCTTATTCACATA pLKO.1 2399 3UTR 100% 4.950 6.930 N MTPAP n/a
3 TRCN0000162057 GCTCCAAACAGAAAGTCCTTT pLKO.1 1666 CDS 100% 4.950 3.960 N MTPAP n/a
4 TRCN0000160380 CGTTGGCAATGAATACATTAA pLKO.1 2328 3UTR 100% 13.200 9.240 N MTPAP n/a
5 TRCN0000162272 CGTGGACAACATAGCAAGATT pLKO.1 2115 3UTR 100% 5.625 3.375 N MTPAP n/a
6 TRCN0000158522 CCTTACAATGATGGTCATCTT pLKO.1 1200 CDS 100% 4.950 2.970 N MTPAP n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3080 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3021 3UTR 100% 4.950 2.475 Y n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3080 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08477 pDONR223 100% 99.7% 99.4% None (many diffs) n/a
2 ccsbBroad304_08477 pLX_304 0% 99.7% 99.4% V5 (many diffs) n/a
3 TRCN0000480889 AACTGTCGAGCAAGCCGTTACTCT pLX_317 20.9% 99.7% 99.4% V5 (many diffs) n/a
Download CSV