Transcript: Human NM_018138.5

Homo sapiens TBCC domain containing 1 (TBCCD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TBCCD1 (55171)
Length:
2700
CDS:
117..1790

Additional Resources:

NCBI RefSeq record:
NM_018138.5
NBCI Gene record:
TBCCD1 (55171)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018138.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412663 TGCCTAACTATTGGGATAATC pLKO_005 1429 CDS 100% 13.200 18.480 N TBCCD1 n/a
2 TRCN0000140853 CCCAATGCTAGAGGACCATAT pLKO.1 1385 CDS 100% 10.800 15.120 N TBCCD1 n/a
3 TRCN0000139450 CTCCCTTACGATCTGTGACAA pLKO.1 1153 CDS 100% 4.950 6.930 N TBCCD1 n/a
4 TRCN0000145278 GCTTCCTTATTGAAGGTACAA pLKO.1 754 CDS 100% 4.950 6.930 N TBCCD1 n/a
5 TRCN0000425058 GTAGAGCCAGGAAGATCTATC pLKO_005 778 CDS 100% 10.800 8.640 N TBCCD1 n/a
6 TRCN0000252657 TTGCTACAGTGCCTAACTATT pLKO_005 1420 CDS 100% 13.200 9.240 N Tbccd1 n/a
7 TRCN0000419532 GATATCCACCTATGTGCAAAT pLKO_005 221 CDS 100% 10.800 7.560 N TBCCD1 n/a
8 TRCN0000413729 GCAGCTGGATAAGGATCTTAC pLKO_005 1779 CDS 100% 10.800 7.560 N TBCCD1 n/a
9 TRCN0000145206 GTTGCATCTTTCACGTTCTTA pLKO.1 1297 CDS 100% 5.625 3.938 N TBCCD1 n/a
10 TRCN0000143841 CATTGCTGTTTGCCATCGTTT pLKO.1 1256 CDS 100% 4.950 3.465 N TBCCD1 n/a
11 TRCN0000139714 CACGCTACAGTTTCTGCTCTT pLKO.1 464 CDS 100% 4.050 2.835 N TBCCD1 n/a
12 TRCN0000139118 CCTGTTTGACTGGGAATCCAT pLKO.1 901 CDS 100% 3.000 2.100 N TBCCD1 n/a
13 TRCN0000143170 GAGGCTCATTTGACAAAGGAT pLKO.1 1644 CDS 100% 3.000 2.100 N TBCCD1 n/a
14 TRCN0000143578 GCCCTGGAAATACAAGGATAA pLKO.1 1813 3UTR 100% 10.800 6.480 N TBCCD1 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2177 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2177 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018138.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03542 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03542 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481001 GCTTTGATCCAGACCCATACCGTA pLX_317 23.1% 100% 100% V5 n/a
Download CSV