Transcript: Human NM_018163.3

Homo sapiens DnaJ heat shock protein family (Hsp40) member C17 (DNAJC17), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DNAJC17 (55192)
Length:
3721
CDS:
28..942

Additional Resources:

NCBI RefSeq record:
NM_018163.3
NBCI Gene record:
DNAJC17 (55192)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018163.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232871 GGTGGAGTTTGCAACCGTCAA pLKO_005 681 CDS 100% 4.050 3.240 N DNAJC17 n/a
2 TRCN0000232872 AGCCACTCAGGACTGTCAAAG pLKO_005 799 CDS 100% 10.800 7.560 N DNAJC17 n/a
3 TRCN0000232868 GCAGCGGACAAAGAGGTAAAG pLKO_005 91 CDS 100% 10.800 7.560 N DNAJC17 n/a
4 TRCN0000074663 CCTGGTGCTTTCCAGTAAGAA pLKO.1 645 CDS 100% 5.625 3.938 N DNAJC17 n/a
5 TRCN0000232870 CCTGGTGCTTTCCAGTAAGAA pLKO_005 645 CDS 100% 5.625 3.938 N DNAJC17 n/a
6 TRCN0000074665 CCTGGTGGATAACCCTCTGAA pLKO.1 735 CDS 100% 4.950 3.465 N DNAJC17 n/a
7 TRCN0000232869 CAGAAGTATGGTGAGGTTCTC pLKO_005 622 CDS 100% 4.050 2.835 N DNAJC17 n/a
8 TRCN0000074666 GCAGCCACTCAGGACTGTCAA pLKO.1 797 CDS 100% 1.650 1.155 N DNAJC17 n/a
9 TRCN0000074664 GCATATGACAAGGTCAGGAAA pLKO.1 238 CDS 100% 0.000 0.000 N DNAJC17 n/a
10 TRCN0000074667 CAGGACACTAGAGCAAGAGAT pLKO.1 390 CDS 100% 4.950 2.970 N DNAJC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018163.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03546 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03546 pLX_304 73.4% 100% 100% V5 n/a
3 TRCN0000465462 TTCACAATTCCGATAGGGCGTGTC pLX_317 36.4% 100% 100% V5 n/a
Download CSV