Transcript: Human NM_018290.4

Homo sapiens phosphoglucomutase 2 (PGM2), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PGM2 (55276)
Length:
3211
CDS:
48..1886

Additional Resources:

NCBI RefSeq record:
NM_018290.4
NBCI Gene record:
PGM2 (55276)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049083 CCTCAGAAACTACGATGGAAA pLKO.1 1535 CDS 100% 4.950 6.930 N PGM2 n/a
2 TRCN0000049087 GCCCTTCACAGTATCACATTT pLKO.1 488 CDS 100% 13.200 10.560 N PGM2 n/a
3 TRCN0000300518 GCCCTTCACAGTATCACATTT pLKO_005 488 CDS 100% 13.200 10.560 N PGM2 n/a
4 TRCN0000304085 CTTGCATTTACCTACAATTAA pLKO_005 1908 3UTR 100% 15.000 10.500 N PGM2 n/a
5 TRCN0000304022 TGGAGTATGGCTACCATATTA pLKO_005 1456 CDS 100% 15.000 10.500 N PGM2 n/a
6 TRCN0000049084 CGACTAATAGCAGAAGGTAAT pLKO.1 156 CDS 100% 10.800 7.560 N PGM2 n/a
7 TRCN0000300519 CGACTAATAGCAGAAGGTAAT pLKO_005 156 CDS 100% 10.800 7.560 N PGM2 n/a
8 TRCN0000049085 CCTGAGTTTCCAACAGTGAAA pLKO.1 903 CDS 100% 4.950 2.970 N PGM2 n/a
9 TRCN0000300517 CCTGAGTTTCCAACAGTGAAA pLKO_005 903 CDS 100% 4.950 2.970 N PGM2 n/a
10 TRCN0000049086 CGCTGTCATAAGTGCAGAGTT pLKO.1 1376 CDS 100% 4.950 2.970 N PGM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14195 pDONR223 100% 99.8% .4% None 9delT;29G>A n/a
2 ccsbBroad304_14195 pLX_304 0% 99.8% .4% V5 (not translated due to prior stop codon) 9delT;29G>A n/a
3 TRCN0000475172 ACAATCGTATCATGACCATCTACC pLX_317 26.8% 99.8% .4% V5 (not translated due to prior stop codon) 9delT;29G>A n/a
Download CSV