Transcript: Human NM_018368.4

Homo sapiens LMBR1 domain containing 1 (LMBRD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LMBRD1 (55788)
Length:
3900
CDS:
130..1752

Additional Resources:

NCBI RefSeq record:
NM_018368.4
NBCI Gene record:
LMBRD1 (55788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018368.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062278 CCTGAAGATCAGTGTACTGTT pLKO.1 1540 CDS 100% 4.950 3.960 N LMBRD1 n/a
2 TRCN0000299478 CCTGAAGATCAGTGTACTGTT pLKO_005 1540 CDS 100% 4.950 3.960 N LMBRD1 n/a
3 TRCN0000062279 GCCTCTTACTACTGGCTATTT pLKO.1 185 CDS 100% 13.200 9.240 N LMBRD1 n/a
4 TRCN0000299479 GCCTCTTACTACTGGCTATTT pLKO_005 185 CDS 100% 13.200 9.240 N LMBRD1 n/a
5 TRCN0000062280 GCGTTACCTTTAAATCTGATA pLKO.1 781 CDS 100% 4.950 3.465 N LMBRD1 n/a
6 TRCN0000299400 GCGTTACCTTTAAATCTGATA pLKO_005 781 CDS 100% 4.950 3.465 N LMBRD1 n/a
7 TRCN0000062282 GCACTTATCACATCAGCACTT pLKO.1 298 CDS 100% 4.050 2.835 N LMBRD1 n/a
8 TRCN0000299402 GCACTTATCACATCAGCACTT pLKO_005 298 CDS 100% 4.050 2.835 N LMBRD1 n/a
9 TRCN0000062281 CCCAATATGTTATGTATGGAA pLKO.1 1427 CDS 100% 3.000 2.100 N LMBRD1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3175 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3175 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018368.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12275 pDONR223 100% 34.7% 29.5% None (many diffs) n/a
2 ccsbBroad304_12275 pLX_304 0% 34.7% 29.5% V5 (many diffs) n/a
3 TRCN0000465863 CCGTGCAACTTTGTCGACCACATC pLX_317 63.6% 34.7% 29.5% V5 (many diffs) n/a
Download CSV