Transcript: Human NM_018370.3

Homo sapiens DNA damage regulated autophagy modulator 1 (DRAM1), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
DRAM1 (55332)
Length:
3279
CDS:
211..927

Additional Resources:

NCBI RefSeq record:
NM_018370.3
NBCI Gene record:
DRAM1 (55332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160268 CGTGCCTTAATCTTTATCTTT pLKO.1 3077 3UTR 100% 5.625 7.875 N DRAM1 n/a
2 TRCN0000162186 CCTACAGTCCATCATCTCTTA pLKO.1 624 CDS 100% 4.950 6.930 N DRAM1 n/a
3 TRCN0000160135 CCTAAGGATATCCACAGAAAT pLKO.1 891 CDS 100% 13.200 9.240 N DRAM1 n/a
4 TRCN0000329023 TGATAAACTTCTCTGCATTTC pLKO_005 386 CDS 100% 10.800 7.560 N Dram1 n/a
5 TRCN0000186838 GCCCTTTAATAAAGCCAAGTA pLKO.1 2336 3UTR 100% 4.950 3.465 N DRAM1 n/a
6 TRCN0000161451 CGAGACAAGAAGAATGGAGAA pLKO.1 1799 3UTR 100% 4.050 2.835 N DRAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03583 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03583 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472156 CCACAGCTCGAGACCGTATTTGCT pLX_317 63.4% 100% 100% V5 n/a
4 ccsbBroadEn_12204 pDONR223 100% 55.4% 55.4% None 1_318del n/a
5 ccsbBroad304_12204 pLX_304 0% 55.4% 55.4% V5 1_318del n/a
6 TRCN0000472687 TATCTTTATCAGCTCGATGGCCGC pLX_317 95.6% 55.4% 55.4% V5 1_318del n/a
Download CSV