Transcript: Human NM_018373.3

Homo sapiens synaptojanin 2 binding protein (SYNJ2BP), mRNA.

Source:
NCBI, updated 2019-05-14
Taxon:
Homo sapiens (human)
Gene:
SYNJ2BP (55333)
Length:
7057
CDS:
128..565

Additional Resources:

NCBI RefSeq record:
NM_018373.3
NBCI Gene record:
SYNJ2BP (55333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140528 GCTTTCATGAGATACCGGCAA pLKO.1 536 CDS 100% 2.160 3.024 N SYNJ2BP n/a
2 TRCN0000144176 CCAGATTTGAAGTGACTGATA pLKO.1 660 3UTR 100% 4.950 3.465 N SYNJ2BP n/a
3 TRCN0000139077 CCTGCTATTCTGCCATGTCTT pLKO.1 622 3UTR 100% 4.950 3.465 N SYNJ2BP n/a
4 TRCN0000145254 GCTTAGAACAAATGAGGAGTT pLKO.1 776 3UTR 100% 4.050 2.835 N SYNJ2BP n/a
5 TRCN0000143136 CCCAAGTGGTATTCCCATATT pLKO.1 469 CDS 100% 13.200 6.600 Y SYNJ2BP n/a
6 TRCN0000121988 GCTGTAGACCTCTTTCGTAAT pLKO.1 368 CDS 100% 10.800 5.400 Y SYNJ2BP n/a
7 TRCN0000142960 CAGAATGGACCTATAGGACAT pLKO.1 434 CDS 100% 4.050 2.025 Y SYNJ2BP n/a
8 TRCN0000139049 CAGGAGGGTGATAAGATCCTT pLKO.1 305 CDS 100% 3.000 1.500 Y SYNJ2BP n/a
9 TRCN0000144682 GAAGAGATCAATCTTACCAGA pLKO.1 161 CDS 100% 2.640 1.320 Y SYNJ2BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08522 pDONR223 100% 99.7% 100% None 424C>A n/a
2 ccsbBroad304_08522 pLX_304 0% 99.7% 100% V5 424C>A n/a
3 TRCN0000478302 CATATGCGTTCGCTCCAACCTGTC pLX_317 70.3% 99.7% 100% V5 424C>A n/a
Download CSV