Transcript: Human NM_018384.4

Homo sapiens GTPase, IMAP family member 5 (GIMAP5), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
GIMAP5 (55340)
Length:
1895
CDS:
368..1291

Additional Resources:

NCBI RefSeq record:
NM_018384.4
NBCI Gene record:
GIMAP5 (55340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436861 GGACCCTGGAGCACTTCTAAT pLKO_005 1298 3UTR 100% 13.200 6.600 Y GIMAP5 n/a
2 TRCN0000428342 TCATCCTCTTCACCCACAAAG pLKO_005 807 CDS 100% 10.800 5.400 Y GIMAP5 n/a
3 TRCN0000048458 CGAGAGTAACTGGGCATACAA pLKO.1 1156 CDS 100% 5.625 2.813 Y GIMAP5 n/a
4 TRCN0000048460 CTGAAGGTAGATCAGAAGATA pLKO.1 405 CDS 100% 5.625 2.813 Y GIMAP5 n/a
5 TRCN0000048459 CCTCAGAGTCAAACACTTGAT pLKO.1 1183 CDS 100% 4.950 2.475 Y GIMAP5 n/a
6 TRCN0000048462 AGGATTATCCTAGTGGGCAAA pLKO.1 452 CDS 100% 4.050 2.025 Y GIMAP5 n/a
7 TRCN0000048461 CCCTGGATGACTATGTAGCAA pLKO.1 846 CDS 100% 3.000 1.500 Y GIMAP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08524 pDONR223 100% 99.8% 99.6% None 913C>G n/a
2 ccsbBroad304_08524 pLX_304 0% 99.8% 99.6% V5 913C>G n/a
3 TRCN0000472183 TACGCCGTAATGAACCATCCGAGC pLX_317 48.7% 99.8% 99.6% V5 913C>G n/a
Download CSV