Transcript: Human NM_018447.3

Homo sapiens ER membrane protein complex subunit 3 (EMC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
EMC3 (55831)
Length:
2660
CDS:
468..1253

Additional Resources:

NCBI RefSeq record:
NM_018447.3
NBCI Gene record:
EMC3 (55831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138221 CAAGATAATGCCGCTGACCAA pLKO.1 1032 CDS 100% 2.640 3.696 N EMC3 n/a
2 TRCN0000135620 GACATGATGAAAGGGAATGTA pLKO.1 792 CDS 100% 5.625 3.938 N EMC3 n/a
3 TRCN0000343067 GACATGATGAAAGGGAATGTA pLKO_005 792 CDS 100% 5.625 3.938 N EMC3 n/a
4 TRCN0000136922 CGCAGACACAAACAAAGCTTT pLKO.1 1100 CDS 100% 4.950 3.465 N EMC3 n/a
5 TRCN0000343068 CGCAGACACAAACAAAGCTTT pLKO_005 1100 CDS 100% 4.950 3.465 N EMC3 n/a
6 TRCN0000135997 GAACAAGTATCTGACAGTCAA pLKO.1 606 CDS 100% 4.950 3.465 N EMC3 n/a
7 TRCN0000343136 GAACAAGTATCTGACAGTCAA pLKO_005 606 CDS 100% 4.950 3.465 N EMC3 n/a
8 TRCN0000137692 GAGTTCTGCATCCTGGTACTT pLKO.1 965 CDS 100% 4.950 3.465 N EMC3 n/a
9 TRCN0000136654 GCACTAGATGATGTCGAAGAA pLKO.1 1164 CDS 100% 4.950 3.465 N EMC3 n/a
10 TRCN0000343137 GCACTAGATGATGTCGAAGAA pLKO_005 1164 CDS 100% 4.950 3.465 N EMC3 n/a
11 TRCN0000135908 GATTCTTATTGGTGGATGGAT pLKO.1 830 CDS 100% 3.000 2.100 N EMC3 n/a
12 TRCN0000137032 CATCACTTTCTTCGTAGGCAT pLKO.1 533 CDS 100% 2.640 1.848 N EMC3 n/a
13 TRCN0000137693 GCTTTCAAGACAGAGTGGGAA pLKO.1 1116 CDS 100% 2.640 1.848 N EMC3 n/a
14 TRCN0000137527 CCCAGGAACAAGTATCTGACA pLKO.1 601 CDS 100% 2.640 1.320 Y EMC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08595 pDONR223 100% 99.8% 100% None 52C>T n/a
2 ccsbBroad304_08595 pLX_304 0% 99.8% 100% V5 52C>T n/a
3 TRCN0000466350 AGCACCGTACTCTTATGAAATACT pLX_317 29.2% 99.8% 100% V5 52C>T n/a
Download CSV