Transcript: Human NM_018466.6

Homo sapiens ALG13 UDP-N-acetylglucosaminyltransferase subunit (ALG13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ALG13 (79868)
Length:
2718
CDS:
50..547

Additional Resources:

NCBI RefSeq record:
NM_018466.6
NBCI Gene record:
ALG13 (79868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018466.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236275 AGCCACTCGTAGTGGTTATAA pLKO_005 330 CDS 100% 15.000 21.000 N ALG13 n/a
2 TRCN0000034823 GCCACTCGTAGTGGTTATAAA pLKO.1 331 CDS 100% 15.000 21.000 N ALG13 n/a
3 TRCN0000034819 CCTTGGTTACAACCGACTTAT pLKO.1 142 CDS 100% 13.200 18.480 N ALG13 n/a
4 TRCN0000236272 CTTGGTTACAACCGACTTATC pLKO_005 143 CDS 100% 10.800 15.120 N ALG13 n/a
5 TRCN0000034821 CCCTTCAGTACTGAGTCGTTT pLKO.1 197 CDS 100% 4.950 6.930 N ALG13 n/a
6 TRCN0000236276 GTCGTTTACTCTGGATGTTTA pLKO_005 211 CDS 100% 13.200 10.560 N ALG13 n/a
7 TRCN0000236273 ACAGAGTGGAGTGGATATATT pLKO_005 1089 3UTR 100% 15.000 10.500 N ALG13 n/a
8 TRCN0000236274 TGTTACAGTCAATGGACTTAT pLKO_005 447 CDS 100% 13.200 9.240 N ALG13 n/a
9 TRCN0000034822 ACCAGCTTTGACGACCTCATT pLKO.1 80 CDS 100% 4.950 3.465 N ALG13 n/a
10 TRCN0000034820 GCTGTTACAGTCAATGGACTT pLKO.1 445 CDS 100% 4.050 2.835 N ALG13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018466.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08974 pDONR223 100% 99.7% 99.3% None 495A>T n/a
2 ccsbBroad304_08974 pLX_304 0% 99.7% 99.3% V5 495A>T n/a
3 TRCN0000468097 GAAGCAGCAAATCCCAAGTAACAG pLX_317 69.1% 99.7% 99.3% V5 495A>T n/a
Download CSV