Transcript: Human NM_018696.3

Homo sapiens elaC ribonuclease Z 1 (ELAC1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ELAC1 (55520)
Length:
2211
CDS:
84..1175

Additional Resources:

NCBI RefSeq record:
NM_018696.3
NBCI Gene record:
ELAC1 (55520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018696.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249002 ACTTCAGTCAGAGGTACAAAC pLKO_005 1021 CDS 100% 10.800 7.560 N Elac1 n/a
2 TRCN0000051826 GTGTCCAAACAGCCTATTGAA pLKO.1 339 CDS 100% 5.625 3.938 N ELAC1 n/a
3 TRCN0000051827 GAAGTGACTCTAGCAGAAGAT pLKO.1 1122 CDS 100% 4.950 3.465 N ELAC1 n/a
4 TRCN0000051823 GCCAACTTAAAGCAGGGAGAA pLKO.1 226 CDS 100% 4.050 2.835 N ELAC1 n/a
5 TRCN0000051824 GCACAGAAACTTAAAGACCTT pLKO.1 687 CDS 100% 2.640 1.848 N ELAC1 n/a
6 TRCN0000051825 CTTCTGTTTGATGATGAACAA pLKO.1 579 CDS 100% 4.950 2.970 N ELAC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018696.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08540 pDONR223 100% 99.9% 99.7% None 16A>T n/a
2 ccsbBroad304_08540 pLX_304 0% 99.9% 99.7% V5 16A>T n/a
3 TRCN0000465934 AGGGATCCAAATCCGCCCCGTTAC pLX_317 38.8% 99.9% 99.7% V5 16A>T n/a
Download CSV